TkA08G430830 | RubberDandelionOmics

Gene overview

TkA08G430830

Reference: TK1151 Chr: Chr08 Coordinates: 109491871-109498977 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1706 bp · TkA08G430830|TK1151|cDNA

AAAGGATTTAGGCCCAACAGACATCAGAAATGTTTGGGCTTCGTCAAAACAAGCTCACTGAGATTATGAACAAGAAAGGTCTAGCGATTTTATTGCGTTCTAAAATGAGGCCTCTCTCTCCTGTCTCTAAGAAAATCAATCGACTGCAAGTTGCTCCTCTGGATGGGAACAGAGTAGCTGCTCAAAATACCTCCAGCAAGACCCCAAGAGATTTTGGGCAAGTACGGGAATCAATGCATTCAGTCATATCAATGAACAGA...

CDS

Download CDS FASTA

1575 bp · TkA08G430830|TK1151|CDS

ATGTTTGGGCTTCGTCAAAACAAGCTCACTGAGATTATGAACAAGAAAGGTCTAGCGATTTTATTGCGTTCTAAAATGAGGCCTCTCTCTCCTGTCTCTAAGAAAATCAATCGACTGCAAGTTGCTCCTCTGGATGGGAACAGAGTAGCTGCTCAAAATACCTCCAGCAAGACCCCAAGAGATTTTGGGCAAGTACGGGAATCAATGCATTCAGTCATATCAATGAACAGAAAAGAGATACTAGATACTGCACTAACTGA...

Protein

Download Protein FASTA

524 aa · TkA08G430830|TK1151|PROTEIN

MFGLRQNKLTEIMNKKGLAILLRSKMRPLSPVSKKINRLQVAPLDGNRVAAQNTSSKTPRDFGQVRESMHSVISMNRKEILDTALTEFSEGYFSLSQENRHKLLLVLAREYDLNRIQVRDLMKQYVGLEIPKGDGSDEHGHEVEGHLSSFYRIERNLRHALNPMYALLFERLNTHPGGLKFLASVRADILSIIADENIASIRALDSYLKEKLITWLSPANLELHQITWDDPASLLEKIVAYEAVHPISNLIDLKRRLGIG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G430830`
TK1151 ID	TkA08G430830
OH-1004 ID	LXL04_034727
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G430830`
Location	Chr08:109491871-109498977 (-)
Description	Similar to MLYCD: Malonyl-CoA decarboxylase, mitochondrial
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_034727` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002931 response to ischemia Biological Process GO:0006085 acetyl-CoA biosynthetic process Biological Process GO:0006633 fatty acid biosynthetic process Biological Process GO:0006637 acyl-CoA metabolic process Biological Process GO:0007584 response to nutrient Biological Process GO:0010906 regulation of glucose metabolic process Biological Process GO:0019395 fatty acid oxidation Biological Process GO:0031998 regulation of fatty acid beta-oxidation Biological Process GO:0046320 regulation of fatty acid oxidation Biological Process GO:0046321 positive regulation of fatty acid oxidation Biological Process GO:2001294 malonyl-CoA catabolic process Biological Process GO:0005737 cytoplasm Cellular Component
KEGG gene cross-reference	hsa:23417 mmu:56690 rno:85239 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.469

Rank 1 · TkA08G430830 · TK1151

Peroxisome0.237

Rank 2 · TkA08G430830 · TK1151

Cytoplasm0.198

Rank 3 · TkA08G430830 · TK1151

Plastid0.096

Rank 4 · TkA08G430830 · TK1151

Nucleus0.095

Rank 5 · TkA08G430830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17408MCD_N61-116 aa

PF17408MCD_N153-215 aa

PF05292MCD221-522 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G430830	`PF17408`	MCD_N	61	116	6.2e-11	43.0
TkA08G430830	`PF17408`	MCD_N	153	215	6.2e-11	43.0
TkA08G430830	`PF05292`	MCD	221	522	9.1e-85	285.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card