TkA08G420800 | RubberDandelionOmics

Gene overview

TkA08G420800

Reference: TK1151 Chr: Chr08 Coordinates: 106969605-106971265 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1359 bp · TkA08G420800|TK1151|cDNA

AAATGATCGGGTTTCACTATAAATGAATCTTTATATATCATTATTCCACATTCCAAATATCCCACAAATAAGTTAAACTTGTTGAAGTCTATCCTCTTCGAAATGGCTGGATTCAAAAACATATTCGGGATTTTCATGCTTCAAATGATGGTCCTCGCACTGTTTTCACTACATGCAGACGGCCAAGGGTTGAAAGTAGGATTTTATGATGAATCATGCCCTCAGGCCGAAGCCATTGTATCTAAGGTCATGAGCAATGT...

CDS

Download CDS FASTA

1002 bp · TkA08G420800|TK1151|CDS

ATGGCTGGATTCAAAAACATATTCGGGATTTTCATGCTTCAAATGATGGTCCTCGCACTGTTTTCACTACATGCAGACGGCCAAGGGTTGAAAGTAGGATTTTATGATGAATCATGCCCTCAGGCCGAAGCCATTGTATCTAAGGTCATGAGCAATGTAATGGCTGTAGCACCTTCTCTCTCTGGCCCTCTGCTGAGATTACACTTCCATGATTGCTTTATTAGGGGCTGTGACGGATCCATTCTTTTGGATACCCCAAC...

Protein

Download Protein FASTA

333 aa · TkA08G420800|TK1151|PROTEIN

MAGFKNIFGIFMLQMMVLALFSLHADGQGLKVGFYDESCPQAEAIVSKVMSNVMAVAPSLSGPLLRLHFHDCFIRGCDGSILLDTPTGQTEKFSPPNLSLRGFNIIDRVKLALEMACPSVVSCADIVALVARDVTVATKGPYWEVETGRKDGNVSLFTDPINGLVTGLPSFTSNITILKQSFSLRGLSTKDLVVLSGGHTIGMSHCSSFEERLYNFTGKGNNDDTDPTMDQNYIARLKLKCKPRDVTTIAELDPGSFKTF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G420800`
TK1151 ID	TkA08G420800
OH-1004 ID	LXL04_034676
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G420800

Location Chr08:106969605-106971265 (+)

Description Similar to PER27: Peroxidase 27

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01190`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At5g15180`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At4g11290`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release
`At1g05260`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0499300`	Removal of H(2)O(2), oxidation of toxic reductants, biosynthesis and degradation of lignin, suberization, auxin catabolism, response to environmental stresses such as wounding, pathogen attack and oxidative stress.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034676 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006950 response to stress Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009269 response to desiccation Biological Process

GO:0009409 response to cold Biological Process

GO:0042538 hyperosmotic salinity response Biological Process

GO:0042744 hydrogen peroxide catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0004601 peroxidase activity Molecular Function

GO:0020037 heme binding Molecular Function

KEGG gene cross-reference

ath:AT1G05260

ath:AT3G01190

ath:AT4G11290

ath:AT5G15180

dosa:Os05g0499300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.324

Rank 1 · TkA08G420800 · TK1151

Lysosome / Vacuole0.249

Rank 2 · TkA08G420800 · TK1151

Cell membrane0.136

Rank 3 · TkA08G420800 · TK1151

Cytoplasm0.090

Rank 4 · TkA08G420800 · TK1151

Endoplasmic reticulum0.076

Rank 5 · TkA08G420800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00141peroxidase46-292 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G420800	`PF00141`	peroxidase	46	292	4.7e-76	256.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q43735`	Arabidopsis thaliana	sp\|Q43735\|PER27_ARATH Peroxidase 27	60.600%	Swiss-Prot	High
`Q9LXG3`	Arabidopsis thaliana	sp\|Q9LXG3\|PER56_ARATH Peroxidase 56	56.000%	Swiss-Prot	High
`Q9SUT2`	Arabidopsis thaliana	sp\|Q9SUT2\|PER39_ARATH Peroxidase 39	50.200%	Swiss-Prot	High
`O23044`	Arabidopsis thaliana	sp\|O23044\|PER3_ARATH Peroxidase 3	52.100%	Swiss-Prot	High
`P37834`	Oryza sativa subsp. japonica	sp\|P37834\|PER1_ORYSJ Peroxidase 1	52.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card