TkA08G413830 | RubberDandelionOmics

Gene overview

TkA08G413830

Reference: TK1151 Chr: Chr08 Coordinates: 105363104-105367355 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2510 bp · TkA08G413830|TK1151|cDNA

TTGTTCTCCACGAGATTTTCTTTACAAACAGGACACCTATAACTTGGGAAGTGCGTGTTTCCGTAACAAAGAAAAGGTCTCCCAAAAGCTCAGCCTCCAACCTTCTTCCTTTAATCCTTTCCTTCAAACGCCGCCATAGTTTTTAATTGGATCGAGCCTTGACGACCACGATCGTATAAGGTGGCGAATGAATCCTTAATCGATTTTGTATTCTGATGATCCATAGCGTTCGAATCACGGGTTGTATCTGTAGAAAATGC...

CDS

Download CDS FASTA

1827 bp · TkA08G413830|TK1151|CDS

ATGTCAAGGCTCTTGGTGATTAAAAGTATTAAAAAAACAGCACAATCAATCCGAACAAGCAACCGGGGAATTCATCCAGAAGACAGGAATCATGGTTCAATCATCAAATCTGGTTTTCACAACTTCAAACAAAGAATGTACTCTCACACCATCAAAAACACCTTCTCCCGAAACTATTCCATCATCCCATCCAATAACACAATAACACATCATGCCCAAATCACATGGAAAAGACTCTCCAAAAACTCCCATCAAGATAC...

Protein

Download Protein FASTA

608 aa · TkA08G413830|TK1151|PROTEIN

MSRLLVIKSIKKTAQSIRTSNRGIHPEDRNHGSIIKSGFHNFKQRMYSHTIKNTFSRNYSIIPSNNTITHHAQITWKRLSKNSHQDTQIPAINKIAQAFTLALTRSYVILPGIFALTYGNIALSDRGPSNLDYLHPRTTLYTHAENGHAFLISSLLSVFEGLILLFRAIYLAILFSPSISMAPFADHFGEPSRKKWLHLVRRTLEIAGPAFIKWGQWAATRPDLFPTDLCTELSKLHSKAPEHSFAYTKKTVEKAFGRKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G413830`
TK1151 ID	TkA08G413830
OH-1004 ID	LXL04_034625
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G413830`
Location	Chr08:105363104-105367355 (+)
Description	Similar to YPL109C: ABC1 family protein YPL109C, mitochondrial (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_034625` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006744 ubiquinone biosynthetic process Biological Process GO:0007005 mitochondrion organization Biological Process GO:0010795 regulation of ubiquinone biosynthetic process Biological Process GO:0055091 phospholipid homeostasis Biological Process GO:0005739 mitochondrion Cellular Component GO:0005743 mitochondrial inner membrane Cellular Component GO:0005886 plasma membrane Cellular Component GO:0031966 mitochondrial membrane Cellular Component GO:0044289 mitochondrial inner-outer membrane contact site Cellular Component GO:0004672 protein kinase activity Molecular Function GO:0004674 protein serine/threonine kinase activity Molecular Function GO:0005524 ATP binding Molecular Function
KEGG gene cross-reference	ddi:DDB_G0267774 sce:YPL109C spo:2540293 vap:Vapar_4126 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.862

Rank 1 · TkA08G413830 · TK1151

Cytoplasm0.064

Rank 2 · TkA08G413830 · TK1151

Plastid0.062

Rank 3 · TkA08G413830 · TK1151

Nucleus0.043

Rank 4 · TkA08G413830 · TK1151

Cell membrane0.029

Rank 5 · TkA08G413830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25218TseH7-66 aa

PF03109ABC1235-498 aa

PF27536UbiB_helical251-263 aa

PF13559DUF4129271-294 aa

PF25218TseH449-520 aa

PF13559DUF4129488-525 aa

PF27536UbiB_helical538-580 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G413830	`PF25218`	TseH	7	66	0.21	12.2
TkA08G413830	`PF03109`	ABC1	235	498	3.4e-48	164.7
TkA08G413830	`PF27536`	UbiB_helical	251	263	0.0059	16.9
TkA08G413830	`PF13559`	DUF4129	271	294	0.13	13.1
TkA08G413830	`PF25218`	TseH	449	520	0.21	12.2
TkA08G413830	`PF13559`	DUF4129	488	525	0.13	13.1
TkA08G413830	`PF27536`	UbiB_helical	538	580	0.0059	16.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card