TkA08G407710 | RubberDandelionOmics

Gene overview

TkA08G407710

Reference: TK1151 Chr: Chr08 Coordinates: 103802372-103809123 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2376 bp · TkA08G407710|TK1151|cDNA

ATTCCTTTTCCTGCCAACCAAACAGCATATGGAATTGGATTCCTTTTCCTTACAGATTCATTTTCCAATTCCTTTTCCTTTTCCATCAGCAACATTCTGCGAACCAAACGCCACCTAAAAGTGATCATAAAATTGCTCCATCTGATTTGCAAATTGGCCTTTATACCCTTGAACCTAATAGGCTAATACCCTCAAACCTCCACAAAAACGCATCATCTTGGAGCCCATTCACGTCGTCACTCTGTGCTCGTCCCTGCTAC...

CDS

Download CDS FASTA

1647 bp · TkA08G407710|TK1151|CDS

ATGTGTGAAAATAGCTGCTTGCTTTTGAAGGATATCTTATTGAAGATTCTTCAATTCAAGATGATTTGGTGTCCTCATTGTTGCAAAAATAGGGAGACAAGCTGTGATTATCGAACAGGCAGCGTATGTTGTGTTGAATGTGGAAAAGTAATATCTCAAGAAACATATACAGATGAAGTCGGTTTTATCAAAGATGCAGGAGGAGGGGCTCATCTGGCAGGCAATGTTGTCAGAATGGCAGGTGATGTGTCAGACTCACA...

Protein

Download Protein FASTA

548 aa · TkA08G407710|TK1151|PROTEIN

MCENSCLLLKDILLKILQFKMIWCPHCCKNRETSCDYRTGSVCCVECGKVISQETYTDEVGFIKDAGGGAHLAGNVVRMAGDVSDSHRRTLEKGNVIIYELINKYGITDVQHATKYYEIAVERGFTRGRRTNQVAAACLYVACREKEKPFLLIEFSSELGVSVYELGTVYLLLCKLLSLQDHPFVQKPVDPSLFMHRYTSGLIKGDGNKKVLNTALHLAVSMKRDWIQTGRKPSGICAAAIYVSSILHGFNFSRTDVVKT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G407710`
TK1151 ID	TkA08G407710
OH-1004 ID	LXL04_034490
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 88.686 / OH-1004 88.182 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G407710`
Location	Chr08:103802372-103809123 (-)
Description	Similar to Brf1: Transcription factor IIIB 90 kDa subunit
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_034490` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0001112 DNA-templated transcription open complex formation Biological Process GO:0006352 DNA-templated transcription initiation Biological Process GO:0006359 regulation of transcription by RNA polymerase III Biological Process GO:0006383 transcription by RNA polymerase III Biological Process GO:0006384 transcription initiation at RNA polymerase III promoter Biological Process GO:0009303 rRNA transcription Biological Process GO:0009304 tRNA transcription Biological Process GO:0043488 regulation of mRNA stability Biological Process GO:0045945 positive regulation of transcription by RNA polymerase III Biological Process GO:0070897 transcription preinitiation complex assembly Biological Process GO:0070898 RNA polymerase III preinitiation complex assembly Biological Process GO:0000126 transcription factor TFIIIB complex Cellular Component
KEGG gene cross-reference	cal:CAALFM_CR05650WA hsa:2972 kla:KLLA0_A05434g sce:YGR246C These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.929

Rank 1 · TkA08G407710 · TK1151

Cytoplasm0.135

Rank 2 · TkA08G407710 · TK1151

Cell membrane0.022

Rank 3 · TkA08G407710 · TK1151

Mitochondrion0.019

Rank 4 · TkA08G407710 · TK1151

Endoplasmic reticulum0.011

Rank 5 · TkA08G407710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08271Zn_Ribbon_TF24-63 aa

PF21886BRF2-like_C_cyclin_rpt110-143 aa

PF00382TFIIB111-174 aa

PF18542TFIIB_C_1113-155 aa

PF20182DUF6545118-147 aa

PF00382TFIIB208-277 aa

PF21886BRF2-like_C_cyclin_rpt209-244 aa

PF07741BRF1442-518 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G407710	`PF08271`	Zn_Ribbon_TF	24	63	0.06	13.6
TkA08G407710	`PF21886`	BRF2-like_C_cyclin_rpt	110	143	0.078	13.8
TkA08G407710	`PF00382`	TFIIB	111	174	2.6e-31	108.2
TkA08G407710	`PF18542`	TFIIB_C_1	113	155	0.14	13.0
TkA08G407710	`PF20182`	DUF6545	118	147	0.096	13.8
TkA08G407710	`PF00382`	TFIIB	208	277	2.6e-31	108.2
TkA08G407710	`PF21886`	BRF2-like_C_cyclin_rpt	209	244	0.078	13.8
TkA08G407710	`PF07741`	BRF1	442	518	1e-12	49.0
TkA08G407710	`PF00382`	TFIIB	472	508	2.6e-31	108.2
TkA08G407710	`PF20182`	DUF6545	472	517	0.096	13.8
TkA08G407710	`PF18542`	TFIIB_C_1	500	516	0.14	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card