TkA08G348610 | RubberDandelionOmics

Gene overview

TkA08G348610

Reference: TK1151 Chr: Chr08 Coordinates: 89334636-89339483 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1470 bp · TkA08G348610|TK1151|cDNA

TTATGATCTTCAAATTTATGCTCTATGCGAGTCTTCTGGATGAAAGCCTCTCTTAGTCTCATAAAACAACCCCAAGTTTTGTACTTCTCGGATCTGTGTTCCGATATAAGCTACTTTAGGTCAGAGATAGGAGCCCTATTTATATTCTCTTGACTGATTCGGATGCTTCCTACTTCGGATTCCATCTCGGCTTCGGAAACTCCATCCAGCATCGGAGACTTGGCGCTTCGGACTCCTCTACCGCTTCGGAATCCCGTTTC...

CDS

Download CDS FASTA

1308 bp · TkA08G348610|TK1151|CDS

ATGCTTCCTACTTCGGATTCCATCTCGGCTTCGGAAACTCCATCCAGCATCGGAGACTTGGCGCTTCGGACTCCTCTACCGCTTCGGAATCCCGTTTCGGCCTCGGAAACCATCTTCCGGAGTCACCCTCTTCCGCAACCCATCCAACTGTCGCAGCAATTTCATAGCTCCGAAGTAACCCTTTTCACGATCATCATCGTTAATTTCAACCTACCAATGAAAGGCGGATTTTCTGTCTCAGATGATTGCTCAGACGGGAG...

Protein

Download Protein FASTA

435 aa · TkA08G348610|TK1151|PROTEIN

MLPTSDSISASETPSSIGDLALRTPLPLRNPVSASETIFRSHPLPQPIQLSQQFHSSEVTLFTIIIVNFNLPMKGGFSVSDDCSDGSSRPSVDASSDCSAPEVDRITIATTTGVTESSQLYGNLFIADFCCWLAAPPGYAHLVQTADSLHLILRLFLIETLFIENEVEALYELFEKLSSSLHVDGLIGKDEFLLPLFRDHGQRKLFADRIFDLFDVNRSGHIDFTEFVRSLGVFHPKAPQAEKILYSSEVQRSSKGAWMA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G348610`
TK1151 ID	TkA08G348610
OH-1004 ID	LXL04_034066
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	79.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G348610

Location Chr08:89334636-89339483 (-)

Description Similar to CBL4: Calcineurin B-like protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24270`	May act as a calcium sensor regulating intracellular Na⁺/K⁺ homeostasis and salt tolerance.	The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3.2000 · DOI: 10.1073/pnas.97.7.3735 SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding.2000 · DOI: 10.1105/tpc.12.9.1667 Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3.2002 · DOI: 10.1073/pnas.122224699 Calcium-dependent modulation and plasma membrane targeting of the AKT2 potassium channel by the CBL4/CIPK6 calcium sensor/protein kinase complex.2011 · DOI: 10.1038/cr.2011.50 Arabidopsis SOS3 plays an important role in salt tolerance by mediating calcium-dependent microfilament reorganization.2013 · DOI: 10.1007/s00299-012-1348-3

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0291000`	Acts as a calcium sensor.	No verified direct reference in this release
`Os05g0534400`	Acts as a calcium sensor involved in the regulatory pathway for the control of intracellular Na(+) and K(+) homeostasis and salt tolerance.	Conservation of the salt overly sensitive pathway in rice.2007 · DOI: 10.1104/pp.106.092635
`Os02g0291400`	Acts as a calcium sensor.	Expression analysis of the calcineurin B-like gene family in rice (Oryza sativa L.) under environmental stresses.2008 · DOI: 10.1016/j.gene.2008.02.011
`Os03g0626800`	Acts as a calcium sensor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034066 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005513 detection of calcium ion Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0030007 intracellular potassium ion homeostasis Biological Process

GO:0042539 hypotonic salinity response Biological Process

GO:0071472 cellular response to salt stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005955 calcineurin complex Cellular Component

KEGG gene cross-reference

ath:AT5G24270

ath:AT5G47100

dosa:Os02g0291000

dosa:Os05g0534400

osa:107276173

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.453

Rank 1 · TkA08G348610 · TK1151

Nucleus0.388

Rank 2 · TkA08G348610 · TK1151

Mitochondrion0.139

Rank 3 · TkA08G348610 · TK1151

Cell membrane0.094

Rank 4 · TkA08G348610 · TK1151

Endoplasmic reticulum0.078

Rank 5 · TkA08G348610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22292DUF696537-62 aa

PF12763EH166-228 aa

PF13499EF-hand_7168-193 aa

PF00036EF-hand_1184-193 aa

PF13405EF-hand_6184-192 aa

PF13499EF-hand_7184-229 aa

PF13202EF-hand_5184-192 aa

PF13833EF-hand_8184-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G348610	`PF22292`	DUF6965	37	62	0.037	14.6
TkA08G348610	`PF12763`	EH	166	228	0.16	12.6
TkA08G348610	`PF13499`	EF-hand_7	168	193	0.00019	22.4
TkA08G348610	`PF00036`	EF-hand_1	184	193	2.2e-06	27.5
TkA08G348610	`PF13405`	EF-hand_6	184	192	0.00013	22.1
TkA08G348610	`PF13499`	EF-hand_7	184	229	0.00019	22.4
TkA08G348610	`PF13202`	EF-hand_5	184	192	0.0002	21.4
TkA08G348610	`PF13833`	EF-hand_8	184	198	0.022	15.2
TkA08G348610	`PF00036`	EF-hand_1	208	229	2.2e-06	27.5
TkA08G348610	`PF13202`	EF-hand_5	208	229	0.0002	21.4
TkA08G348610	`PF13833`	EF-hand_8	208	229	0.022	15.2
TkA08G348610	`PF13405`	EF-hand_6	209	231	0.00013	22.1
TkA08G348610	`PF08069`	Ribosomal_S13_N	274	301	0.019	15.7
TkA08G348610	`PF13833`	EF-hand_8	415	426	0.022	15.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81223`	Arabidopsis thaliana	sp\|O81223\|CNBL4_ARATH Calcineurin B-like protein 4	65.900%	Swiss-Prot	Low
`Q3HRP0`	Oryza sativa subsp. japonica	sp\|Q3HRP0\|CNBL7_ORYSJ Calcineurin B-like protein 7	62.900%	Swiss-Prot	Low
`Q75KU4`	Oryza sativa subsp. japonica	sp\|Q75KU4\|CNBL4_ORYSJ Calcineurin B-like protein 4	51.800%	Swiss-Prot	Low
`Q3HRN9`	Oryza sativa subsp. japonica	sp\|Q3HRN9\|CNBL8_ORYSJ Calcineurin B-like protein 8	58.400%	Swiss-Prot	Low
`Q75LU8`	Oryza sativa subsp. japonica	sp\|Q75LU8\|CNBL3_ORYSJ Calcineurin B-like protein 3	44.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card