TkA08G337860 | RubberDandelionOmics

Gene overview

TkA08G337860

Reference: TK1151 Chr: Chr08 Coordinates: 86698511-86702683 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1622 bp · TkA08G337860|TK1151|cDNA

GAAATCCGCTTTAAGCTCACATCCGACTTCGAAGTGACTTTTGCGGCCAACGTTTTGTCTGTCGAGGGCTCAATTCAACCACAGATTTGCTCCACGTACAATCTAAATAGAGGGATGATGAAGTCTGCTGGAAATGCTTTGCTTTCTTCTTTTTCACCTCCTTATATATTTCCCAAAAAAAACTATCGCAGATTGCCTCCAAATTTACTCTGTGGAATTTCAACCTGTAAATCAAGGAAACTACATTCAAAATCAGATAT...

CDS

Download CDS FASTA

1323 bp · TkA08G337860|TK1151|CDS

GAAATCCGCTTTAAGCTCACATCCGACTTCGAAGTGACTTTTGCGGCCAACGTTTTGTCTGTCGAGGGCTCAATTCAACCACAGATTTGCTCCACGTACAATCTAAATAGAGGGATGATGAAGTCTGCTGGAAATGCTTTGCTTTCTTCTTTTTCACCTCCTTATATATTTCCCAAAAAAAACTATCGCAGATTGCCTCCAAATTTACTCTGTGGAATTTCAACCTGTAAATCAAGGAAACTACATTCAAAATCAGATAT...

Protein

Download Protein FASTA

440 aa · TkA08G337860|TK1151|PROTEIN

EIRFKLTSDFEVTFAANVLSVEGSIQPQICSTYNLNRGMMKSAGNALLSSFSPPYIFPKKNYRRLPPNLLCGISTCKSRKLHSKSDMVVEQYLPPWFSVAPMMEWTDNHYRTMARLVSKHAWLYTEMLAAETIVYQEKNLDRFLAFSPEQHPIVLQIGGNNLENLAKATRLANTYGYDEINLNCGCPSPKVAGHGCFGVRLMLDPKFVAEAMCVIAANTDAPVSVKCRIGVDDHDSYNQLCDFIYKVSSQSPTRHFVIHS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G337860`
TK1151 ID	TkA08G337860
OH-1004 ID	LXL04_034030
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.000
Protein coverage (%)	TK1151 100.000 / OH-1004 69.391 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G337860`
Location	Chr08:86698511-86702683 (-)
Description	Similar to dusA: tRNA-dihydrouridine(20/20a) synthase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_034030` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000049 tRNA binding Molecular Function GO:0010181 FMN binding Molecular Function GO:0050660 flavin adenine dinucleotide binding Molecular Function GO:0102264 tRNA-dihydrouridine20 synthase activity Molecular Function GO:0102266 tRNA-dihydrouridine20a synthase activity Molecular Function
KEGG gene cross-reference	stm:STM4243 stt:t4149 sty:STY4439 vch:VC_0379 vpa:VP2727 vvu:VV1_1398 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.803

Rank 1 · TkA08G337860 · TK1151

Mitochondrion0.261

Rank 2 · TkA08G337860 · TK1151

Cytoplasm0.039

Rank 3 · TkA08G337860 · TK1151

Nucleus0.027

Rank 4 · TkA08G337860 · TK1151

Peroxisome0.013

Rank 5 · TkA08G337860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01207Dus99-386 aa

PF07366SnoaL284-329 aa

PF00977His_biosynth289-329 aa

PF07366SnoaL380-397 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G337860	`PF01207`	Dus	99	386	5.3e-55	187.4
TkA08G337860	`PF07366`	SnoaL	284	329	0.29	11.7
TkA08G337860	`PF00977`	His_biosynth	289	329	0.0025	18.0
TkA08G337860	`PF07366`	SnoaL	380	397	0.29	11.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card