TkA08G270280 | RubberDandelionOmics

Gene overview

TkA08G270280

Reference: TK1151 Chr: Chr08 Coordinates: 70417330-70418922 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

867 bp · TkA08G270280|TK1151|cDNA

ATGCTTGGCGATCCTTCAAACTCAGTGGCTATTGAACAAAATAGTGTTTCAGATGTAGCCTTAGCCGTCCAACATGTTGGATACCAGGAATATGCTGTCCAGGTACTGTCTCCTTCGTGCGGGCATATACAACATACCTTTTTGCATGCCAACAATAGATATATTGCCGAAAAATTAAACGCTTTATGCCTCAAAGATAAAGGGCTCCTGTATGAGGATCCTTATATTCAGGGTCACCTTGTACTTTTCTTGGGAAACAA...

CDS

Download CDS FASTA

867 bp · TkA08G270280|TK1151|CDS

ATGCTTGGCGATCCTTCAAACTCAGTGGCTATTGAACAAAATAGTGTTTCAGATGTAGCCTTAGCCGTCCAACATGTTGGATACCAGGAATATGCTGTCCAGGTACTGTCTCCTTCGTGCGGGCATATACAACATACCTTTTTGCATGCCAACAATAGATATATTGCCGAAAAATTAAACGCTTTATGCCTCAAAGATAAAGGGCTCCTGTATGAGGATCCTTATATTCAGGGTCACCTTGTACTTTTCTTGGGAAACAA...

Protein

Download Protein FASTA

288 aa · TkA08G270280|TK1151|PROTEIN

MLGDPSNSVAIEQNSVSDVALAVQHVGYQEYAVQVLSPSCGHIQHTFLHANNRYIAEKLNALCLKDKGLLYEDPYIQGHLVLFLGNKNATVSLESIQAVILPPSHLKVELSLVPELIPPKAQIQCEFEVVNVNPSSDVAVLDFSYKFQTYLVKILLRLPAVLNKFLYPIQVSDLEFFPTWRSLAGPPLRLQQVVGGVRPMSLLEMENVFDSLRMMVCPGLDPNPNKLIASTTYYSESTGGMLCLMRMETDPADRTHLRMI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G270280`
TK1151 ID	TkA08G270280
OH-1004 ID	LXL04_033519
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	81.800
Protein coverage (%)	TK1151 91.319 / OH-1004 87.458 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G270280

Location Chr08:70417330-70418922 (+)

Description Similar to ALPHAC-AD: AP-2 complex subunit alpha-2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g22780`	Subunit of the adaptor protein complex 2 (AP-2).	Identification and functional characterization of Arabidopsis AP180, a binding partner of plant alphaC-adaptin.2004 · DOI: 10.1242/jcs.01062
`At5g22770`	Subunit of the adaptor protein complex 2 (AP-2).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033519 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006897 endocytosis Biological Process

GO:0006971 hypotonic response Biological Process

GO:0008104 intracellular protein localization Biological Process

GO:0008356 asymmetric cell division Biological Process

GO:0009992 intracellular water homeostasis Biological Process

GO:0010508 positive regulation of autophagy Biological Process

GO:0015031 protein transport Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0030100 regulation of endocytosis Biological Process

GO:0031623 receptor internalization Biological Process

GO:0038010 positive regulation of signal transduction by receptor internalization Biological Process

KEGG gene cross-reference

ath:AT5G22770

ath:AT5G22780

ddi:DDB_G0273439

ddi:DDB_G0273501

dme:Dmel_CG4260

dpo:4817178

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.609

Rank 1 · TkA08G270280 · TK1151

Nucleus0.328

Rank 2 · TkA08G270280 · TK1151

Golgi apparatus0.115

Rank 3 · TkA08G270280 · TK1151

Endoplasmic reticulum0.092

Rank 4 · TkA08G270280 · TK1151

Cell membrane0.072

Rank 5 · TkA08G270280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02883Alpha_adaptinC277-147 aa

PF02296Alpha_adaptin_C129-158 aa

PF02296Alpha_adaptin_C164-280 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G270280	`PF02883`	Alpha_adaptinC2	77	147	0.0013	19.7
TkA08G270280	`PF02296`	Alpha_adaptin_C	129	158	1.7e-13	51.5
TkA08G270280	`PF02296`	Alpha_adaptin_C	164	280	1.7e-13	51.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPK4`	Arabidopsis thaliana	sp\|Q8LPK4\|AP2A2_ARATH AP-2 complex subunit alpha-2	61.600%	Swiss-Prot	High
`Q8LPL6`	Arabidopsis thaliana	sp\|Q8LPL6\|AP2A1_ARATH AP-2 complex subunit alpha-1	60.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card