TkA08G267840 | RubberDandelionOmics

Gene overview

TkA08G267840

Reference: TK1151 Chr: Chr08 Coordinates: 69814419-69815213 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

795 bp · TkA08G267840|TK1151|cDNA

ATGATCACACCCGAAACCACCCATCCCCAGCCCTTCCACAGGTTTTTTGACTGTTGGCTCGTAGAGCTAAATACCAATCTCGAAAAGCTCGTCTCTGCCGCCAACCACCACCACCACCGTAAAGATAATTCTATGGAAGACGACTCAGATTTACACTTGATTGTTAACAAAGTTGTGGAGCACTACGAGGATTACTACAAAGCCAAATCTGATGGAGCAAAAGAAGACGTGTATTCGATGTTTTCGCCCACATGGCTCAC...

CDS

Download CDS FASTA

795 bp · TkA08G267840|TK1151|CDS

ATGATCACACCCGAAACCACCCATCCCCAGCCCTTCCACAGGTTTTTTGACTGTTGGCTCGTAGAGCTAAATACCAATCTCGAAAAGCTCGTCTCTGCCGCCAACCACCACCACCACCGTAAAGATAATTCTATGGAAGACGACTCAGATTTACACTTGATTGTTAACAAAGTTGTGGAGCACTACGAGGATTACTACAAAGCCAAATCTGATGGAGCAAAAGAAGACGTGTATTCGATGTTTTCGCCCACATGGCTCAC...

Protein

Download Protein FASTA

264 aa · TkA08G267840|TK1151|PROTEIN

MITPETTHPQPFHRFFDCWLVELNTNLEKLVSAANHHHHRKDNSMEDDSDLHLIVNKVVEHYEDYYKAKSDGAKEDVYSMFSPTWLTSLEDGLLWIAGWRPSTAIHLLYSKSGMQLEARLSDLIPVLSCGDLGDLTSYQMQAIDELQRKIVREERLVTEKMATLQETAADTDMVDLSNQKSEMIRETEDGGGKDIDQRVKSLLTEKKDELEEVLHIADDLRMKTLKSVVGILTPLQAVYFLIAAAELHLRIHDWGQKRDA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G267840`
TK1151 ID	TkA08G267840
OH-1004 ID	LXL04_033486
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	69.300
Protein coverage (%)	TK1151 98.864 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G267840

Location Chr08:69814419-69815213 (+)

Description Similar to DOGL3: Protein DOG1-like 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18680`	Protein DOG1-like 2.	No verified direct reference in this release
`At5g06950`	Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.	Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to a defense gene promoter in Arabidopsis.2003 · DOI: 10.1105/tpc.012211
`At3g12250`	Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.	No verified direct reference in this release
`At5g06960`	Transcriptional activator that binds specifically to the DNA sequence 5'-TGACG-3'.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0687700`	Plays a negative role in rice basal defense responses to the bacterial blight pathogen Xanthomomas oryzae pv. oryzae (Xoo).	Alteration of TGA factor activity in rice results in enhanced tolerance to Xanthomonas oryzae pv. oryzae.2005 · DOI: 10.1111/j.1365-313x.2005.02457.x A Genetic Screen Identifies a Requirement for Cysteine-Rich-Receptor-Like Kinases in Rice NH1 (OsNPR1)-Mediated Immunity.2016 · DOI: 10.1371/journal.pgen.1006049

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033486 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010162 seed dormancy process Biological Process

GO:0010182 sugar mediated signaling pathway Biological Process

GO:2000033 regulation of seed dormancy process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0042802 identical protein binding Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT4G18650

ath:AT4G18660

ath:AT4G18680

ath:AT4G18690

ath:AT5G45830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.485

Rank 1 · TkA08G267840 · TK1151

Nucleus0.452

Rank 2 · TkA08G267840 · TK1151

Plastid0.090

Rank 3 · TkA08G267840 · TK1151

Cell membrane0.081

Rank 4 · TkA08G267840 · TK1151

Endoplasmic reticulum0.062

Rank 5 · TkA08G267840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14144DOG129-110 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G267840	`PF14144`	DOG1	29	110	7.7e-28	97.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SN45`	Arabidopsis thaliana	sp\|Q9SN45\|DOGL2_ARATH Protein DOG1-like 2	30.700%	Swiss-Prot	Medium
`P43273`	Arabidopsis thaliana	sp\|P43273\|TGA2_ARATH Transcription factor TGA2	29.700%	Swiss-Prot	Low
`Q39140`	Arabidopsis thaliana	sp\|Q39140\|TGA6_ARATH Transcription factor TGA6	28.500%	Swiss-Prot	Low
`Q39163`	Arabidopsis thaliana	sp\|Q39163\|TGA5_ARATH Transcription factor TGA5	29.200%	Swiss-Prot	Low
`Q7X993`	Oryza sativa subsp. japonica	sp\|Q7X993\|TGA21_ORYSJ Transcription factor TGA2.1	29.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card