TkA08G266440 | RubberDandelionOmics

Gene overview

TkA08G266440

Reference: TK1151 Chr: Chr08 Coordinates: 69432512-69437194 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1242 bp · TkA08G266440|TK1151|cDNA

CGGAGGTGAGGTTGTAATTTCTAGTCAAAAACTCGCTCATCCGTTCTATGGACAAGTACGAGGTGGTGAAGGATCTAGGGTCGGGGAATTTTGGGGTCGCAAGGCTCATGAGACATAAAGAAACCAAAGATCTTGTTGCCATGAAATACATCGAGCGCGGTCAAAAGATTGACGAAAATGTGGCAAGAGAGATCATAAATCATAGGTCGCTTCGTCATCCTAATATCATCCGGTTTAAGGAGGTTGTATTGACTCCAACG...

CDS

Download CDS FASTA

1065 bp · TkA08G266440|TK1151|CDS

ATGGACAAGTACGAGGTGGTGAAGGATCTAGGGTCGGGGAATTTTGGGGTCGCAAGGCTCATGAGACATAAAGAAACCAAAGATCTTGTTGCCATGAAATACATCGAGCGCGGTCAAAAGATTGACGAAAATGTGGCAAGAGAGATCATAAATCATAGGTCGCTTCGTCATCCTAATATCATCCGGTTTAAGGAGGTTGTATTGACTCCAACGCATCTAGCAATAGTAATGGAGTATGCTGCTGGCGGAGAGCTCTTTGA...

Protein

Download Protein FASTA

354 aa · TkA08G266440|TK1151|PROTEIN

MDKYEVVKDLGSGNFGVARLMRHKETKDLVAMKYIERGQKIDENVAREIINHRSLRHPNIIRFKEVVLTPTHLAIVMEYAAGGELFDRICTAGRFSEDEARYFFQQLISGVSFCHSMQICHRDLKLENTLLDGSRAPRLKICDFGYSKSSLLHSIPKSTVGTPAYIAPEVLSRREYDGKLADVWSCGVTLYVMLVGAYPFEDPTDPKNFRKTISRIMGIQYKIPDYVHVSQECKQLLSRIFVANPSRRITIKELKNHPWF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G266440`
TK1151 ID	TkA08G266440
OH-1004 ID	LXL04_033475
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	97.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G266440

Location Chr08:69432512-69437194 (-)

Description Similar to SAPK7: Serine/threonine-protein kinase SAPK7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g10940`	Serine/threonine-protein kinase SRK2A.	No verified direct reference in this release
`At5g63650`	Serine/threonine-protein kinase SRK2H.	No verified direct reference in this release
`At5g08590`	Serine/threonine-protein kinase SRK2G.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0432000`	May play a role in signal transduction of hyperosmotic response.	No verified direct reference in this release
`Os02g0551100`	May play a role in signal transduction of hyperosmotic response (Probable).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033475 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0048527 lateral root development Biological Process

GO:0080022 primary root development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G10940

ath:AT1G60940

ath:AT5G08590

dosa:Os02g0551100

dosa:Os04g0432000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.569

Rank 1 · TkA08G266440 · TK1151

Nucleus0.426

Rank 2 · TkA08G266440 · TK1151

Cell membrane0.169

Rank 3 · TkA08G266440 · TK1151

Golgi apparatus0.052

Rank 4 · TkA08G266440 · TK1151

Mitochondrion0.050

Rank 5 · TkA08G266440 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase4-260 aa

PF07714PK_Tyr_Ser-Thr6-256 aa

PF06293Kdo24-144 aa

PF21636PPP1R21_C226-276 aa

PF21636PPP1R21_C297-344 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G266440	`PF00069`	Pkinase	4	260	1.7e-73	248.0
TkA08G266440	`PF07714`	PK_Tyr_Ser-Thr	6	256	1.3e-32	113.9
TkA08G266440	`PF06293`	Kdo	24	144	0.18	11.9
TkA08G266440	`PF21636`	PPP1R21_C	226	276	0.028	15.2
TkA08G266440	`PF21636`	PPP1R21_C	297	344	0.028	15.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P43291`	Arabidopsis thaliana	sp\|P43291\|SRK2A_ARATH Serine/threonine-protein kinase SRK2A	80.200%	Swiss-Prot	High
`Q9FFP9`	Arabidopsis thaliana	sp\|Q9FFP9\|SRK2H_ARATH Serine/threonine-protein kinase SRK2H	78.900%	Swiss-Prot	High
`P43292`	Arabidopsis thaliana	sp\|P43292\|SRK2G_ARATH Serine/threonine-protein kinase SRK2G	84.800%	Swiss-Prot	High
`Q7XQP4`	Oryza sativa subsp. japonica	sp\|Q7XQP4\|SAPK7_ORYSJ Serine/threonine-protein kinase SAPK7	82.000%	Swiss-Prot	High
`Q6ZI44`	Oryza sativa subsp. japonica	sp\|Q6ZI44\|SAPK6_ORYSJ Serine/threonine-protein kinase SAPK6	78.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card