TkA08G265640 | RubberDandelionOmics

Gene overview

TkA08G265640

Reference: TK1151 Chr: Chr08 Coordinates: 69227094-69233078 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1306 bp · TkA08G265640|TK1151|cDNA

GTTTCCATTCTCTCAAACACGCAAACGGTCTGGCTTATGGAGAAGAAAAGGAGATTGGAACAGGTCGATGGCCGCTTGCAACAATATTTGGTTCTTCTTCTTGCTATTGTTTTAGGGTTTCTGATCATGGATCCTTTCGATATGAGTCCTGTTGGTGGACATAATTTCCGACCTGTGAAAAATGATATTGCCCCGTATGACCAAGTGATGGAGAGTTGGCCCATTGACAATCTTAGCCGGTTAGGGCTTGGGAACTTGGA...

CDS

Download CDS FASTA

1053 bp · TkA08G265640|TK1151|CDS

ATGGAGAAGAAAAGGAGATTGGAACAGGTCGATGGCCGCTTGCAACAATATTTGGTTCTTCTTCTTGCTATTGTTTTAGGGTTTCTGATCATGGATCCTTTCGATATGAGTCCTGTTGGTGGACATAATTTCCGACCTGTGAAAAATGATATTGCCCCGTATGACCAAGTGATGGAGAGTTGGCCCATTGACAATCTTAGCCGGTTAGGGCTTGGGAACTTGGAGCATGTAGATAAAGTGTTCGGACCCGAGTCCCTGGA...

Protein

Download Protein FASTA

350 aa · TkA08G265640|TK1151|PROTEIN

MEKKRRLEQVDGRLQQYLVLLLAIVLGFLIMDPFDMSPVGGHNFRPVKNDIAPYDQVMESWPIDNLSRLGLGNLEHVDKVFGPESLEFDPLGNGPYTGMADGRIVKWSGDGRGWQTFALVSRDWSERLCMRGKDSTTYKQWKMEAICGRPLGLRFDKGSGNLYIADAYYGLMVVGPEGGLATPLATHIDGEPIIFANDLDIHSNGSIFFTDTSQKYNRVNHFFIMLEGEATGRLLRYDPPTKSTRVVLNGLAFPNGVQLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G265640`
TK1151 ID	TkA08G265640
OH-1004 ID	LXL04_033433
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 99.714 / OH-1004 85.749 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G265640

Location Chr08:69227094-69233078 (-)

Description Similar to SSL13: Protein STRICTOSIDINE SYNTHASE-LIKE 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59530`	Required for the exine formation during pollen development.	No verified direct reference in this release
`At1g08470`	Protein STRICTOSIDINE SYNTHASE-LIKE 3.	No verified direct reference in this release
`At3g57030`	Protein STRICTOSIDINE SYNTHASE-LIKE 10.	No verified direct reference in this release
`At3g57020`	Protein STRICTOSIDINE SYNTHASE-LIKE 9.	No verified direct reference in this release
`At2g41290`	Protein STRICTOSIDINE SYNTHASE-LIKE 2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033433 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009555 pollen development Biological Process

GO:0010584 pollen exine formation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016787 hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT1G08470

ath:AT3G57010

ath:AT3G57020

ath:AT3G57030

ath:AT3G59530

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.539

Rank 1 · TkA08G265640 · TK1151

Golgi apparatus0.165

Rank 2 · TkA08G265640 · TK1151

Cytoplasm0.122

Rank 3 · TkA08G265640 · TK1151

Cell membrane0.094

Rank 4 · TkA08G265640 · TK1151

Lysosome / Vacuole0.090

Rank 5 · TkA08G265640 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20067SSL_N73-107 aa

PF08450SGL132-314 aa

PF01436NHL149-167 aa

PF03088Str_synth197-284 aa

PF01436NHL197-212 aa

PF20067SSL_N198-210 aa

PF01731Arylesterase204-319 aa

PF01436NHL251-261 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G265640	`PF20067`	SSL_N	73	107	0.00028	21.4
TkA08G265640	`PF08450`	SGL	132	314	1.3e-17	64.9
TkA08G265640	`PF01436`	NHL	149	167	0.018	15.8
TkA08G265640	`PF03088`	Str_synth	197	284	8.2e-31	106.7
TkA08G265640	`PF01436`	NHL	197	212	0.018	15.8
TkA08G265640	`PF20067`	SSL_N	198	210	0.00028	21.4
TkA08G265640	`PF01731`	Arylesterase	204	319	0.00089	18.8
TkA08G265640	`PF01436`	NHL	251	261	0.018	15.8
TkA08G265640	`PF03088`	Str_synth	298	320	8.2e-31	106.7
TkA08G265640	`PF01436`	NHL	301	313	0.018	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M1B4`	Arabidopsis thaliana	sp\|Q9M1B4\|SSL13_ARATH Protein STRICTOSIDINE SYNTHASE-LIKE 13	68.700%	Swiss-Prot	High
`Q8VWF6`	Arabidopsis thaliana	sp\|Q8VWF6\|SSL3_ARATH Protein STRICTOSIDINE SYNTHASE-LIKE 3	44.700%	Swiss-Prot	Medium
`Q4V3D9`	Arabidopsis thaliana	sp\|Q4V3D9\|SSL10_ARATH Protein STRICTOSIDINE SYNTHASE-LIKE 10	49.000%	Swiss-Prot	Medium
`Q9M1J6`	Arabidopsis thaliana	sp\|Q9M1J6\|SSL9_ARATH Protein STRICTOSIDINE SYNTHASE-LIKE 9	42.700%	Swiss-Prot	Medium
`Q9SLG8`	Arabidopsis thaliana	sp\|Q9SLG8\|SSL2_ARATH Protein STRICTOSIDINE SYNTHASE-LIKE 2	42.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card