TkA08G258000 | RubberDandelionOmics

Gene overview

TkA08G258000

Reference: TK1151 Chr: Chr08 Coordinates: 67261641-67264354 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1190 bp · TkA08G258000|TK1151|cDNA

CAGGATTTCACTCTGAAGTCATTGAGGAGAAAAGTATCGACGTTGAACACAAACGAGAGAATTTCATCCTCTCCGCAAGTAATCGAACCCGTGGCTGCCCAGGGTGCTTGTTTTCATTCGACTAAAGCCTGGGAGGGGATTTGAGAAAAAGCTGTAAAAGATGAAGAAGAACAAAAATTTCCGAAAACGAAGTATAGCAGACGTTGAAGATGAACAACCAGGTGTTACAGAAGACGGCAATGAGATGCGATTAGCCTTAG...

CDS

Download CDS FASTA

867 bp · TkA08G258000|TK1151|CDS

ATGAAGAAGAACAAAAATTTCCGAAAACGAAGTATAGCAGACGTTGAAGATGAACAACCAGGTGTTACAGAAGACGGCAATGAGATGCGATTAGCCTTAGAAGAAGTCAAATTTCTTCAGAAACTGAGGGAGAAGAAGTCAGGAGTCCCAGCGATTGTTAAAACAGGGCAGGCTGCTGCAGCTAGTGGCGTCAACAATGCCGGTGGGTTGGCTCCCAAAGGTGGTGATAAAGGTGAAGGGGATGAAAAAGACGACTTGGT...

Protein

Download Protein FASTA

288 aa · TkA08G258000|TK1151|PROTEIN

MKKNKNFRKRSIADVEDEQPGVTEDGNEMRLALEEVKFLQKLREKKSGVPAIVKTGQAAAASGVNNAGGLAPKGGDKGEGDEKDDLVLQDTFAQETAVMDEDPHMLKYVEQELAKKKGKNIDEADQVENDIKRAEDELYKIPEHLKVKRRNSEESSTQWTTGIAEIQLPIEFKLKNIEETEAAKKLLQEKRLMGSRGPKTDSTIPSSFSADYFQRGKDYAEKLRRDHPELYKDKGANKNGEARAADSAAAVDGGAGGGGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G258000`
TK1151 ID	TkA08G258000
OH-1004 ID	LXL04_033457
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G258000

Location Chr08:67261641-67264354 (+)

Description Similar to CSU2: Protein COP1 SUPPRESSOR 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g02330`	Inhibits E3 ubiquitin-protein ligase activity of COP1, a central repressor of seedling photomorphogenesis.	Arabidopsis COP1 SUPPRESSOR 2 Represses COP1 E3 Ubiquitin Ligase Activity through Their Coiled-Coil Domains Association.2015 · DOI: 10.1371/journal.pgen.1005747

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033457 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0007059 chromosome segregation Biological Process

GO:0010099 regulation of photomorphogenesis Biological Process

GO:0031397 negative regulation of protein ubiquitination Biological Process

GO:0045292 mRNA cis splicing, via spliceosome Biological Process

GO:0055121 response to high fluence blue light stimulus by blue high-fluence system Biological Process

GO:0060629 regulation of homologous chromosome segregation Biological Process

GO:0080022 primary root development Biological Process

GO:0000775 chromosome, centromeric region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

KEGG gene cross-reference

ath:AT1G02330

hsa:51759

mmu:227707

pon:100172237

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.964

Rank 1 · TkA08G258000 · TK1151

Cytoplasm0.117

Rank 2 · TkA08G258000 · TK1151

Cell membrane0.014

Rank 3 · TkA08G258000 · TK1151

Mitochondrion0.013

Rank 4 · TkA08G258000 · TK1151

Endoplasmic reticulum0.008

Rank 5 · TkA08G258000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07052Hep_5926-40 aa

PF15843DUF471950-154 aa

PF07052Hep_5991-186 aa

PF15843DUF4719232-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G258000	`PF07052`	Hep_59	26	40	6.9e-28	98.1
TkA08G258000	`PF15843`	DUF4719	50	154	0.059	13.9
TkA08G258000	`PF07052`	Hep_59	91	186	6.9e-28	98.1
TkA08G258000	`PF15843`	DUF4719	232	267	0.059	13.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HVZ5`	Arabidopsis thaliana	sp\|F4HVZ5\|CSU2_ARATH Protein COP1 SUPPRESSOR 2	65.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card