TkA08G257550 | RubberDandelionOmics

Gene overview

TkA08G257550

Reference: TK1151 Chr: Chr08 Coordinates: 67143839-67146610 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1939 bp · TkA08G257550|TK1151|cDNA

CTATTTCATTTCAATAATGGACAAATAAAACGGGGTTGCCAAGTCAGAATGTCATGTGCGACGTCAATACCGCTTTTCTACTTTGCTATAGAACCCTGAAACCCTAGCTACGTTTCTGCTCAATATTATCGCCTTAGCCACCCCACCACCACTACCAGTCGTTTAACGATCGGAGAATCTGTACAACGGCTCGGCAGTTCTGTGTTTCTTCACTCAAAAGGCTGGGTGTTCACTTAGGGTTTCTACAATTTTGTGAGGTT...

CDS

Download CDS FASTA

1395 bp · TkA08G257550|TK1151|CDS

ATGTCTCGAAAAGGTTTAATGGAGCAGGATTTGAGCAAGCTGGATGTGACGAAACTACATCCGCTCTCACCGGAGGTCATTTCTCGCCAGGCCACAATTAATATCGGTACTATCGGTCATGTGGCACATGGCAAGTCTACAGTTGTGAAAGCAATATCTGGAGTGCAGACTGTTCGTTTTAAAAATGAGTTGGAGCGTAACATTACCATCAAGCTTGGGTACGCCAATGCAAAGATCTACAAATGTGAAGATGACAGGTG...

Protein

Download Protein FASTA

464 aa · TkA08G257550|TK1151|PROTEIN

MSRKGLMEQDLSKLDVTKLHPLSPEVISRQATINIGTIGHVAHGKSTVVKAISGVQTVRFKNELERNITIKLGYANAKIYKCEDDRCPRPMCYKAYGSGKEDSPQCDVPGFENSKMTLMRHVSFVDCPGHDILMATMLNGAAIMDGALLLIAANESCPQPQTSEHLAAVEIMRLQHIIILQNKVDLIQENVAINQHESIQKFIQGTVADGAPVIPVSAQLKYNIDVVCEYIIKRIPIPERNFISPPNMIVIRSFDVNKPG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G257550`
TK1151 ID	TkA08G257550
OH-1004 ID	LXL04_033452
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G257550`
Location	Chr08:67143839-67146610 (-)
Description	Similar to eIF2gamma: Eukaryotic translation initiation factor 2 subunit 3
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_033452` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0001731 formation of translation preinitiation complex Biological Process GO:0002183 cytoplasmic translational initiation Biological Process GO:0006413 translational initiation Biological Process GO:0006446 regulation of translational initiation Biological Process GO:0007283 spermatogenesis Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0005850 eukaryotic translation initiation factor 2 complex Cellular Component GO:0016282 eukaryotic 43S preinitiation complex Cellular Component GO:0043614 multi-eIF complex Cellular Component GO:0070062 extracellular exosome Cellular Component GO:0000049 tRNA binding Molecular Function
KEGG gene cross-reference	dme:Dmel_CG43665 gga:418597 hsa:1968 rno:100312984 rno:299027 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.487

Rank 1 · TkA08G257550 · TK1151

Nucleus0.403

Rank 2 · TkA08G257550 · TK1151

Mitochondrion0.103

Rank 3 · TkA08G257550 · TK1151

Cell membrane0.089

Rank 4 · TkA08G257550 · TK1151

Endoplasmic reticulum0.045

Rank 5 · TkA08G257550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00009GTP_EFTU32-236 aa

PF01926MMR_HSR135-155 aa

PF00350Dynamin_N36-59 aa

PF03193RsgA_GTPase38-59 aa

PF00350Dynamin_N117-130 aa

PF03193RsgA_GTPase141-232 aa

PF16897MMR_HSR1_Xtn177-234 aa

PF09173eIF2_C185-200 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G257550	`PF00009`	GTP_EFTU	32	236	7.3e-27	94.9
TkA08G257550	`PF01926`	MMR_HSR1	35	155	0.087	13.7
TkA08G257550	`PF00350`	Dynamin_N	36	59	0.1	13.4
TkA08G257550	`PF03193`	RsgA_GTPase	38	59	0.004	17.7
TkA08G257550	`PF00350`	Dynamin_N	117	130	0.1	13.4
TkA08G257550	`PF03193`	RsgA_GTPase	141	232	0.004	17.7
TkA08G257550	`PF16897`	MMR_HSR1_Xtn	177	234	0.099	13.4
TkA08G257550	`PF09173`	eIF2_C	185	200	4.4e-33	114.1
TkA08G257550	`PF03144`	GTP_EFTU_D2	268	350	6.6e-08	33.6
TkA08G257550	`PF09173`	eIF2_C	362	451	4.4e-33	114.1
TkA08G257550	`PF03144`	GTP_EFTU_D2	373	391	6.6e-08	33.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card