TkA08G243200 | RubberDandelionOmics

Gene overview

TkA08G243200

Reference: TK1151 Chr: Chr08 Coordinates: 63547038-63548902 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1635 bp · TkA08G243200|TK1151|cDNA

CACCTAAAACCATGACCATGAACCACCGCCATTTCCTTCTCGTGTCTTTACCATTCCAAAGCCACATCAGCCCCGCTTTCCGACTAGCCACCAAACTCATAAGCGCCGGTGCTCAAGTCACCTTGGCCACCACCGTCGACGGCCTCAAAACCCGCCCTGCAGTCCCCGGTTTATCTTACCATTTCTTCTCCGACGACGGTGCCGCCGGAAAACCAGGCTACATTCAAAAAATCAAGCTCGTTGGGCCCACGAACCTCAAA...

CDS

Download CDS FASTA

1320 bp · TkA08G243200|TK1151|CDS

ATGACCATGAACCACCGCCATTTCCTTCTCGTGTCTTTACCATTCCAAAGCCACATCAGCCCCGCTTTCCGACTAGCCACCAAACTCATAAGCGCCGGTGCTCAAGTCACCTTGGCCACCACCGTCGACGGCCTCAAAACCCGCCCTGCAGTCCCCGGTTTATCTTACCATTTCTTCTCCGACGACGGTGCCGCCGGAAAACCAGGCTACATTCAAAAAATCAAGCTCGTTGGGCCCACGAACCTCAAAAAGCTCTTGGT...

Protein

Download Protein FASTA

439 aa · TkA08G243200|TK1151|PROTEIN

MTMNHRHFLLVSLPFQSHISPAFRLATKLISAGAQVTLATTVDGLKTRPAVPGLSYHFFSDDGAAGKPGYIQKIKLVGPTNLKKLLVTVANEGHKVDFLIYGICLPWVAEVAREHHVPSALFYIQSAASFSVAYHLYNTDGGLVNTDIDYTGTLKVPGLPLLKYSEVPPFLLPTDPLALVFQEHIEIVEKDPNSFVLLNSFNYLEEESIEAVSDRINIFSVGPLVSGETEEPYVSDTFQDSDRGTYLRWLDSKPEKSVVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G243200`
TK1151 ID	TkA08G243200
OH-1004 ID	LXL04_033239
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 97.950 / OH-1004 99.768 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G243200`
Location	Chr08:63547038-63548902 (+)
Description	Similar to UGT75L6: Crocetin glucosyltransferase, chloroplastic
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_033239` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process GO:0009737 response to abscisic acid Biological Process GO:0009738 abscisic acid-activated signaling pathway Biological Process GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process GO:0009835 fruit ripening Biological Process GO:0009845 seed germination Biological Process GO:0043473 pigmentation Biological Process GO:0080148 negative regulation of response to water deprivation Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0009507 chloroplast Cellular Component GO:0008194 UDP-glycosyltransferase activity Molecular Function
KEGG gene cross-reference	ag:BAA36421 ag:BAK55736 mdm:103443397 sly:101250450 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.759

Rank 1 · TkA08G243200 · TK1151

Nucleus0.209

Rank 2 · TkA08G243200 · TK1151

Endoplasmic reticulum0.077

Rank 3 · TkA08G243200 · TK1151

Peroxisome0.069

Rank 4 · TkA08G243200 · TK1151

Cell membrane0.050

Rank 5 · TkA08G243200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06289FlbD182-219 aa

PF00201UDPGT250-412 aa

PF07249Cerato-platanin300-340 aa

PF06722EryCIII-like_C314-411 aa

PF28035Cys_rich_PSPA7_2676328-351 aa

PF04101Glyco_tran_28_C330-369 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G243200	`PF06289`	FlbD	182	219	0.32	11.3
TkA08G243200	`PF00201`	UDPGT	250	412	1.1e-26	94.5
TkA08G243200	`PF07249`	Cerato-platanin	300	340	0.043	14.7
TkA08G243200	`PF06722`	EryCIII-like_C	314	411	0.00017	22.3
TkA08G243200	`PF28035`	Cys_rich_PSPA7_2676	328	351	0.58	10.9
TkA08G243200	`PF04101`	Glyco_tran_28_C	330	369	0.061	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card