TkA08G241000 | RubberDandelionOmics

Gene overview

TkA08G241000

Reference: TK1151 Chr: Chr08 Coordinates: 62858956-62859711 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

726 bp · TkA08G241000|TK1151|cDNA

ATGGTGAAATCTCACGAAGATTTCGATCGAGAGGTTCGAGTTTTGTCAAAAGCAAGACACCCTAATCTCGTATCCGTCAAAGGGTATTTCTGGAAACCCGAGTTACAGCTTCTAGTAACAGAGTATGTATCAAACAGTAGCTTACAGTCCAAACTCCATAACCAGTCAACTTCAAGTCAACTTTCATGGTCAACGCGTTTCAATATCTTGTTAGGAACCGCAAATGGGTTAGCCCATTTACACCATTCGTTTCGCCCACC...

CDS

Download CDS FASTA

726 bp · TkA08G241000|TK1151|CDS

ATGGTGAAATCTCACGAAGATTTCGATCGAGAGGTTCGAGTTTTGTCAAAAGCAAGACACCCTAATCTCGTATCCGTCAAAGGGTATTTCTGGAAACCCGAGTTACAGCTTCTAGTAACAGAGTATGTATCAAACAGTAGCTTACAGTCCAAACTCCATAACCAGTCAACTTCAAGTCAACTTTCATGGTCAACGCGTTTCAATATCTTGTTAGGAACCGCAAATGGGTTAGCCCATTTACACCATTCGTTTCGCCCACC...

Protein

Download Protein FASTA

241 aa · TkA08G241000|TK1151|PROTEIN

MVKSHEDFDREVRVLSKARHPNLVSVKGYFWKPELQLLVTEYVSNSSLQSKLHNQSTSSQLSWSTRFNILLGTANGLAHLHHSFRPPLVHYNLKANNILLDENLNPKISDFGLTRIMAKHDKQGYVAPELACQSLRVNEKCDVYGFGVLILEVVTGKRAIEYGDDNVLILSEEVRGMLEEGNVLECVDLRMGEYREDEVLPVLKLALVCTSQIPSSRPSMAEVVQILQVIRTPVRHRMEAY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G241000`
TK1151 ID	TkA08G241000
OH-1004 ID	LXL04_033208
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.600
Protein coverage (%)	TK1151 100.000 / OH-1004 25.150 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G241000

Location Chr08:62858956-62859711 (-)

Description Similar to At3g28040: Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g28040`	Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040.	No verified direct reference in this release
`At3g56370`	Probable LRR receptor-like serine/threonine-protein kinase IRK.	No verified direct reference in this release
`At5g01890`	Leucine-rich repeat receptor-like protein kinase that may play a role in vascular tissues development.	No verified direct reference in this release
`At1g12460`	Probable LRR receptor-like serine/threonine-protein kinase At1g12460.	No verified direct reference in this release
`At4g28650`	Involved in the regulation of procambium maintenance and polarity during vascular-tissue development.	A receptor heteromer mediates the male perception of female attractants in plants.2016 · DOI: 10.1038/nature16975

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033208 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0009755 hormone-mediated signaling pathway Biological Process

GO:0009934 regulation of meristem structural organization Biological Process

GO:0010067 procambium histogenesis Biological Process

GO:0010075 regulation of meristem growth Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0030154 cell differentiation Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0048229 gametophyte development Biological Process

GO:0048364 root development Biological Process

GO:0048437 floral organ development Biological Process

KEGG gene cross-reference

ath:AT3G28040

ath:AT3G49670

ath:AT3G56370

ath:AT4G28650

ath:AT5G01890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.491

Rank 1 · TkA08G241000 · TK1151

Cell membrane0.400

Rank 2 · TkA08G241000 · TK1151

Nucleus0.295

Rank 3 · TkA08G241000 · TK1151

Golgi apparatus0.042

Rank 4 · TkA08G241000 · TK1151

Endoplasmic reticulum0.037

Rank 5 · TkA08G241000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714PK_Tyr_Ser-Thr3-227 aa

PF00069Pkinase5-225 aa

PF12260PIP49_C37-113 aa

PF12330Haspin_kinase61-121 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G241000	`PF07714`	PK_Tyr_Ser-Thr	3	227	3.8e-31	109.1
TkA08G241000	`PF00069`	Pkinase	5	225	9.7e-29	101.3
TkA08G241000	`PF12260`	PIP49_C	37	113	0.03	14.6
TkA08G241000	`PF12330`	Haspin_kinase	61	121	0.025	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LRT1`	Arabidopsis thaliana	sp\|Q9LRT1\|Y3804_ARATH Probably inactive leucine-rich repeat receptor-like protein kinase At3g28040	65.700%	Swiss-Prot	High
`Q9LY03`	Arabidopsis thaliana	sp\|Q9LY03\|IRK_ARATH Probable LRR receptor-like serine/threonine-protein kinase IRK	49.400%	Swiss-Prot	Medium
`Q9LZV7`	Arabidopsis thaliana	sp\|Q9LZV7\|PXC2_ARATH Leucine-rich repeat receptor-like protein kinase PXC2	50.200%	Swiss-Prot	High
`C0LGE4`	Arabidopsis thaliana	sp\|C0LGE4\|Y1124_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g12460	45.000%	Swiss-Prot	Medium
`Q9M0G7`	Arabidopsis thaliana	sp\|Q9M0G7\|MIK1_ARATH MDIS1-interacting receptor like kinase 1	39.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card