TkA08G235870 | RubberDandelionOmics

Gene overview

TkA08G235870

Reference: TK1151 Chr: Chr08 Coordinates: 61462970-61466077 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1676 bp · TkA08G235870|TK1151|cDNA

AAGGCTGGCGGGAGTGGGTGGAGCCACATTCGCTGTCGAATCTTATCGACTACATTTCCCTCTTTACTGTCTTCATTCCAGCAGCTTAGATCGGAATCATAGCATAAAACCTCAACTTTTTCTTCCAACTGATTCACACACACAAAGAGAGTGAGAGAGATGAGGGAGATCATAAGCATACACATAGGTCAAGCCGGAATTCAGGTTGGGAATTCATGTTGGGAGCTTTACTGCCTCGAACATGGCATTCAGCCCGATGG...

CDS

Download CDS FASTA

1350 bp · TkA08G235870|TK1151|CDS

ATGAGGGAGATCATAAGCATACACATAGGTCAAGCCGGAATTCAGGTTGGGAATTCATGTTGGGAGCTTTACTGCCTCGAACATGGCATTCAGCCCGATGGTTTGATGCCTAGTGACACCACACCAGGGGTTGCAGATGATGCATTCAACACCTTCTTCAGTGAAACCGGTGCAGGAAAGCATGTCCCAAGAGCAATATTCGTTGACCTTGAACCAACAGTCATCGATGAAGTCAGAACAGGAACTTACCGCCAACTCTT...

Protein

Download Protein FASTA

449 aa · TkA08G235870|TK1151|PROTEIN

MREIISIHIGQAGIQVGNSCWELYCLEHGIQPDGLMPSDTTPGVADDAFNTFFSETGAGKHVPRAIFVDLEPTVIDEVRTGTYRQLFHPEQLISGKEDAANNFARGHYTVGKEIVDLCLDRIRKLADNCTGLQGFLAFNAVGGGTGSGLGSLLLERLSVDYGKKSKLGFTIYPSPQVSTAVVEPYNSVLSTHALLEHTDVAVLLDNEAIYDICRKSLDIERPTYTNLNRLISQTISSLTTSLRFDGAINVDITEFQTNLV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G235870`
TK1151 ID	TkA08G235870
OH-1004 ID	LXL04_033157
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 98.249 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G235870

Location Chr08:61462970-61466077 (-)

Description Similar to TUBA5: Tubulin alpha-5 chain

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19770`	Tubulin is the major constituent of microtubules, a cylinder consisting of laterally associated linear protofilaments composed of alpha- and beta-tubulin heterodimers.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0574800`	Tubulin is the major constituent of microtubules, a cylinder consisting of laterally associated linear protofilaments composed of alpha- and beta-tubulin heterodimers.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033157 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0000278 mitotic cell cycle Biological Process

GO:0007017 microtubule-based process Biological Process

GO:0071258 cellular response to gravity Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005874 microtubule Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT5G19770

ath:AT5G19780

zma:542582

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.763

Rank 1 · TkA08G235870 · TK1151

Mitochondrion0.147

Rank 2 · TkA08G235870 · TK1151

Nucleus0.100

Rank 3 · TkA08G235870 · TK1151

Peroxisome0.033

Rank 4 · TkA08G235870 · TK1151

Cell membrane0.028

Rank 5 · TkA08G235870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00091Tubulin3-213 aa

PF03953Tubulin_C263-392 aa

PF23947DUF7281312-357 aa

PF30605DUF8666411-431 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G235870	`PF00091`	Tubulin	3	213	5.2e-62	210.2
TkA08G235870	`PF03953`	Tubulin_C	263	392	1.7e-51	174.3
TkA08G235870	`PF23947`	DUF7281	312	357	0.088	13.1
TkA08G235870	`PF30605`	DUF8666	411	431	0.25	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q56WH1`	Arabidopsis thaliana	sp\|Q56WH1\|TBA3_ARATH Tubulin alpha-3 chain	96.000%	Swiss-Prot	High
`P28752`	Oryza sativa subsp. japonica	sp\|P28752\|TBA1_ORYSJ Tubulin alpha-1 chain	96.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card