TkA08G227710 | RubberDandelionOmics

Gene overview

TkA08G227710

Reference: TK1151 Chr: Chr08 Coordinates: 59288805-59297519 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5672 bp · TkA08G227710|TK1151|cDNA

AAGAACTTCAAAAAAGGGGCATAACTGTAATTTGGAATCCTCTGGTACTTTCCTGTGGAAGCTAAAGGCGTTCAGAGGTTTCCGTATTCCGGCCTTCTCCCCGTTTCCCTCGTTTTCCACCGTCGGAGAACCTTTACCACGCCGTAGAGTATTCACTCCATGTGAAGAAACAATCGATGTATGTATGATCGTCTAAACCCCCAATCTGACAATTCCAGTTGCCACAATGGCAAATGATAATGGAAATATAAAGTCAAAGA...

CDS

Download CDS FASTA

4980 bp · TkA08G227710|TK1151|CDS

ATGGCAAATGATAATGGAAATATAAAGTCAAAGAAGAAAGATGCATCAACTTCTTCACTCTCAGCATCAATTGATACCTCTGGTTTAAGAAGGTCAGCCAGAGAAACAGCAATTCAGTCCAATGCTCGTAGGTCTGAACAAATTGAGACTCAGACAACACCAACCCCTTCTCCAATTAAGAGGAAACCAGATAAAGTTGAGGAACAGATGGGGCCAAGTCATTTGAGGAGGTCTGATAGAAGCAAGAAACAACTTTCAAC...

Protein

Download Protein FASTA

1659 aa · TkA08G227710|TK1151|PROTEIN

MANDNGNIKSKKKDASTSSLSASIDTSGLRRSARETAIQSNARRSEQIETQTTPTPSPIKRKPDKVEEQMGPSHLRRSDRSKKQLSTDASGSKKLVELPVSLSPIIKSKKEKTASSPKEDAGDVSAENKSDNKNEGHDPDIGGRKRKRMTVRGYKSLFNPQRLRIEADGQHSHESGRITESGNVEKQIGGKCSQDNDGNMMTQNMAIDACEDNDKQISPKSPSSQCKKHGEGEQIMAIDASEDNDKQISPKSPSSECKKH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G227710`
TK1151 ID	TkA08G227710
OH-1004 ID	LXL04_032669
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	37.200
Protein coverage (%)	TK1151 22.061 / OH-1004 49.130 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G227710

Location Chr08:59288805-59297519 (+)

Description Similar to MOM1: Helicase protein MOM1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g08060`	Together with PIAL1 and PIAL2, regulates transcriptional gene silencing (TGS) independently of changes in DNA methylation.	Two regulatory levels of transcriptional gene silencing in Arabidopsis.2002 · DOI: 10.1073/pnas.202380499 Two means of transcriptional reactivation within heterochromatin.2003 · DOI: 10.1046/j.1365-313x.2003.01667.x Epigenetic regulation of transcription in intermediate heterochromatin.2006 · DOI: 10.1038/sj.embor.7400835 MOM1 mediates DNA-methylation-independent silencing of repetitive sequences in Arabidopsis.2006 · DOI: 10.1038/sj.embor.7400791 Divergent evolution of CHD3 proteins resulted in MOM1 refining epigenetic control in vascular plants.2008 · DOI: 10.1371/journal.pgen.1000165 MOM1 and Pol-IV/V interactions regulate the intensity and specificity of transcriptional gene silencing.2010 · DOI: 10.1038/emboj.2009.328 Locus-specific dependency of endogenous silent loci on MOM1 and non-CG methylation in Arabidopsis thaliana.2010 · DOI: 10.4161/psb.5.6.11663 MORPHEUS' MOLECULE1 is required to prevent aberrant RNA transcriptional read-through in Arabidopsis.2010 · DOI: 10.1104/pp.110.162131 Transcriptional silencing induced by Arabidopsis T-DNA mutants is associated with 35S promoter siRNAs and requires genes involved in siRNA-mediated chromatin silencing.2010 · DOI: 10.1111/j.1365-313x.2010.04358.x Structural basis of transcriptional gene silencing mediated by Arabidopsis MOM1.2012 · DOI: 10.1371/journal.pgen.1002484 The SUMO E3 Ligase-Like Proteins PIAL1 and PIAL2 Interact with MOM1 and Form a Novel Complex Required for Transcriptional Silencing.2016 · DOI: 10.1105/tpc.15.00997

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032669 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007051 spindle organization Biological Process

GO:0007098 centrosome cycle Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0031507 heterochromatin formation Biological Process

GO:0042659 regulation of cell fate specification Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045814 negative regulation of gene expression, epigenetic Biological Process

KEGG gene cross-reference

ath:AT1G08060

ath:AT5G44800

hsa:1107

hsa:6594

mmu:93761

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.945

Rank 1 · TkA08G227710 · TK1151

Cytoplasm0.114

Rank 2 · TkA08G227710 · TK1151

Cell membrane0.033

Rank 3 · TkA08G227710 · TK1151

Endoplasmic reticulum0.015

Rank 4 · TkA08G227710 · TK1151

Mitochondrion0.013

Rank 5 · TkA08G227710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25029MOM1821-936 aa

PF25029MOM11367-1386 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G227710	`PF25029`	MOM1	821	936	1.7e-36	125.5
TkA08G227710	`PF25029`	MOM1	1367	1386	1.7e-36	125.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M658`	Arabidopsis thaliana	sp\|Q9M658\|MOM1_ARATH Helicase protein MOM1	31.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card