TkA08G212930 | RubberDandelionOmics

Gene overview

TkA08G212930

Reference: TK1151 Chr: Chr08 Coordinates: 55701022-55705579 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1183 bp · TkA08G212930|TK1151|cDNA

AGACAAAGCTCACCTAATAATTTCTGTTGCGTGAAATATTATCAGTTGAATCACTGCAGATTAAGGCACAGATATAGCTCAATCGATCTTCTCGAAGGGTGAAGAATGAGGGGTAGAAGTTACAGTTACAGCCCTTCACCACCAAGGTACCATAGCAGAAGGAATCGAAGCCCTAGTCCACGGGGTCGTTATGGTGGTCATGCTAGAGATCTTCCTACTAGCCTTTTAGTTCGAAATCTTCGCCTTGATTGCAGACCAGA...

CDS

Download CDS FASTA

594 bp · TkA08G212930|TK1151|CDS

ATGAGGGGTAGAAGTTACAGTTACAGCCCTTCACCACCAAGGTACCATAGCAGAAGGAATCGAAGCCCTAGTCCACGGGGTCGTTATGGTGGTCATGCTAGAGATCTTCCTACTAGCCTTTTAGTTCGAAATCTTCGCCTTGATTGCAGACCAGAAGATCTCCGTGTGCCATTTGGAGAGTTTGGCCCTCTGAAGGATGTTTACTTGCCACGAGACTATTATACAGGAGAGCCACGTGGATTTGGTTTTGTTCAGTTTCT...

Protein

Download Protein FASTA

197 aa · TkA08G212930|TK1151|PROTEIN

MRGRSYSYSPSPPRYHSRRNRSPSPRGRYGGHARDLPTSLLVRNLRLDCRPEDLRVPFGEFGPLKDVYLPRDYYTGEPRGFGFVQFLDPQDAAEAKYEMDGQILLGRELTVVFAEENRKKPSDMRARERFRGRSYDRRGSSTRYSRSPPRGRSYHRSPRYRTPPRRHRYSRSISPYDRRRSYSRSPDGSRSRSPDAY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G212930`
TK1151 ID	TkA08G212930
OH-1004 ID	LXL04_032906
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G212930

Location Chr08:55701022-55705579 (+)

Description Similar to SCL30A: Serine/arginine-rich SC35-like splicing factor SCL30A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g13570`	Involved in intron recognition and spliceosome assembly.	Identification of an intronic splicing regulatory element involved in auto-regulation of alternative splicing of SCL33 pre-mRNA.2012 · DOI: 10.1111/tpj.12004
`At1g55310`	Involved in intron recognition and spliceosome assembly.	No verified direct reference in this release
`At5g18810`	Involved in intron recognition and spliceosome assembly (Probable).	No verified direct reference in this release
`At3g55460`	Involved in intron recognition and spliceosome assembly (Probable).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032906 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000375 RNA splicing, via transesterification reactions Biological Process

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006376 mRNA splice site recognition Biological Process

GO:0008380 RNA splicing Biological Process

GO:0016482 cytosolic transport Biological Process

GO:0048024 regulation of mRNA splicing, via spliceosome Biological Process

GO:0048025 negative regulation of mRNA splicing, via spliceosome Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

KEGG gene cross-reference

ath:AT1G55310

ath:AT3G13570

ath:AT3G55460

ath:AT5G18810

mmu:14105

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.971

Rank 1 · TkA08G212930 · TK1151

Cytoplasm0.184

Rank 2 · TkA08G212930 · TK1151

Cell membrane0.015

Rank 3 · TkA08G212930 · TK1151

Endoplasmic reticulum0.009

Rank 4 · TkA08G212930 · TK1151

Mitochondrion0.008

Rank 5 · TkA08G212930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076RRM_140-109 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G212930	`PF00076`	RRM_1	40	109	2.5e-18	66.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LHP2`	Arabidopsis thaliana	sp\|Q9LHP2\|SL30A_ARATH Serine/arginine-rich SC35-like splicing factor SCL30A	68.900%	Swiss-Prot	High
`Q9SEU4`	Arabidopsis thaliana	sp\|Q9SEU4\|SRC33_ARATH Serine/arginine-rich SC35-like splicing factor SCL33	64.200%	Swiss-Prot	High
`Q1PDV2`	Arabidopsis thaliana	sp\|Q1PDV2\|SRC28_ARATH Serine/arginine-rich SC35-like splicing factor SCL28	52.600%	Swiss-Prot	Medium
`Q8L3X8`	Arabidopsis thaliana	sp\|Q8L3X8\|SRC30_ARATH Serine/arginine-rich SC35-like splicing factor SCL30	61.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card