TkA08G200270 | RubberDandelionOmics

Gene overview

TkA08G200270

Reference: TK1151 Chr: Chr08 Coordinates: 52277596-52283381 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3118 bp · TkA08G200270|TK1151|cDNA

ATTTCAGGAAGGTCGTTTCAGACATTCGCAATCAAGGTGAAGGGGATCGATCTCATTTCAATCGAGAATTAGGGCTGTCTGTTCTACGAGTTTTCCGAATTGGGTTTCATTAGTTCGATTATGTTGGGGGTTTTCCACCTTTTGACGCCAAAAGAAGTCGGCATTCGATCTCAGCTTTTATGCGCATTAAGATTCAATGCCATCATCCGGATTAACCTCTGTTTCTCCGTAGGGTTTGAGTTATTTGATTCGGATTAGTT...

CDS

Download CDS FASTA

2298 bp · TkA08G200270|TK1151|CDS

ATGTTGTTATCCTTGCTGAGTAAGAGAACATTAAATGCAGAATCCAGAGATGCATATGGATTTACTGTGAGACCTCAGTACCTTGACACATTCAAAGAGTTTAATAATATCTATAAGAAGGAGGAAGAAGAAAGGTCAACAAAATGGAGGACCTTTCTCGAGCAACAAGAAGAGCTTGTTCAATTAAACGCATCCATCAACGAGGCCCCCACTGAACCCGATACTGATGAAGTTTCACAACAGGAAACCGATCATGTCTT...

Protein

Download Protein FASTA

765 aa · TkA08G200270|TK1151|PROTEIN

MLLSLLSKRTLNAESRDAYGFTVRPQYLDTFKEFNNIYKKEEEERSTKWRTFLEQQEELVQLNASINEAPTEPDTDEVSQQETDHVLESNQEGDVVSDKKPPTEDSSNSDNNETGKEPVWKNTLSILEKVVADAKPATTHALQNWTDVRTSLNTMEDVMCHRLKNPHELGPIKEESADADEDTSPNSSSYPLKELESLVIGGVPRDLRGEVWQAFVGVKARRVERYYQNLLEVGEDGNNELRDQIKSNPEKLGKKTEKAI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G200270`
TK1151 ID	TkA08G200270
OH-1004 ID	LXL04_032711
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G200270`
Location	Chr08:52277596-52283381 (-)
Description	Similar to TBC1D8: TBC1 domain family member 8
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_032711` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0003008 system process Biological Process GO:0008015 blood circulation Biological Process GO:0008284 positive regulation of cell population proliferation Biological Process GO:0005737 cytoplasm Cellular Component GO:0016020 membrane Cellular Component GO:0005096 GTPase activator activity Molecular Function GO:0005509 calcium ion binding Molecular Function
KEGG gene cross-reference	ani:ANIA_11010 hsa:11138 hsa:23061 mmu:54610 mmu:76795 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.476

Rank 1 · TkA08G200270 · TK1151

Golgi apparatus0.247

Rank 2 · TkA08G200270 · TK1151

Cell membrane0.232

Rank 3 · TkA08G200270 · TK1151

Nucleus0.168

Rank 4 · TkA08G200270 · TK1151

Lysosome / Vacuole0.103

Rank 5 · TkA08G200270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23436RabGap-TBC_234-69 aa

PF00566RabGAP-TBC44-95 aa

PF00566RabGAP-TBC206-431 aa

PF23436RabGap-TBC_2289-427 aa

PF29599Rv0250c593-677 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G200270	`PF23436`	RabGap-TBC_2	34	69	8.9e-27	94.9
TkA08G200270	`PF00566`	RabGAP-TBC	44	95	5.1e-57	193.7
TkA08G200270	`PF00566`	RabGAP-TBC	206	431	5.1e-57	193.7
TkA08G200270	`PF23436`	RabGap-TBC_2	289	427	8.9e-27	94.9
TkA08G200270	`PF29599`	Rv0250c	593	677	0.67	10.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card