TkA08G170740 | RubberDandelionOmics

Gene overview

TkA08G170740

Reference: TK1151 Chr: Chr08 Coordinates: 44648694-44660858 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2258 bp · TkA08G170740|TK1151|cDNA

TTACAATGAACATTAACATCCTCCAAGTGGGAATTTTATTTGCTAGAATTGAATTTAGGCTGACGGCGTCGTATCGGGTGTAAGAAACTGAGAGAAAGACCTTGGTCTCTCCTCTCCCGCAACAGGAAGCTTGCTCTTCTTCATCGACAAAACCCTCCACCTTTCCGTTCACAACCATGGAACAACAAGGCCCCTCACTTGACGACTGCTTAAAGCTATTAAAGGGACAGAGAGACGAACAACGCCTCGCCGGTCTTCTT...

CDS

Download CDS FASTA

1866 bp · TkA08G170740|TK1151|CDS

ATGGAACAACAAGGCCCCTCACTTGACGACTGCTTAAAGCTATTAAAGGGACAGAGAGACGAACAACGCCTCGCCGGTCTTCTTCTCGCCACCAAATTCTGCAAAAACGACGACTTTCCCTCCATTTTAAGGGTTTACAATGCCCTCGGCAACACTTTCTTGGACCGCCTTCTCCGAACCGGGATGGGGAAAGGAAACACAAAAGAGAGTCGCCAAGATAACCAAGATGCTTATCTACAGCTATCTGTCACAATTTTAGC...

Protein

Download Protein FASTA

621 aa · TkA08G170740|TK1151|PROTEIN

MEQQGPSLDDCLKLLKGQRDEQRLAGLLLATKFCKNDDFPSILRVYNALGNTFLDRLLRTGMGKGNTKESRQDNQDAYLQLSVTILAAFCRVPNIASSNDMLNKIPLIIQLLSKELGPPLVEECLEFLYLVSAAHPDGSRIFYVSKGITILASHMPNLPDGSHTMELAMKLLQLTINKLSLDTITKEYCSELSSLVTIVAKQFALLHNALKFEALHLLSMILSSIYAAPVHETLRAMNSLTWSTYLRVGVVAILQNRVAP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G170740`
TK1151 ID	TkA08G170740
OH-1004 ID	LXL04_032385
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 91.324 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G170740

Location Chr08:44648694-44660858 (-)

Description Similar to Ncdn: Neurochondrin

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32520`	Catalyzes the interconversion of serine and glycine and directs the hydroxymethyl moiety of serine into the metabolic network of H4PteGlu(n)-bound one-carbon units.	One-carbon metabolism in plants: characterization of a plastid serine hydroxymethyltransferase.2010 · DOI: 10.1042/bj20100566
`At4g37930`	Functions in the photorespiratory pathway in catalyzing the interconversion of serine and glycine.	Arabidopsis SHMT1, a serine hydroxymethyltransferase that functions in the photorespiratory pathway influences resistance to biotic and abiotic stress.2005 · DOI: 10.1111/j.1365-313x.2004.02311.x The photorespiratory Arabidopsis shm1 mutant is deficient in SHM1.2006 · DOI: 10.1104/pp.105.071399 The presequence of Arabidopsis serine hydroxymethyltransferase SHM2 selectively prevents import into mesophyll mitochondria.2011 · DOI: 10.1104/pp.111.184564 Ubiquitin-specific protease16 modulates salt tolerance in Arabidopsis by regulating Na(+)/H(+) antiport activity and serine hydroxymethyltransferase stability.2012 · DOI: 10.1105/tpc.112.106393
`At5g26780`	Functions outside the photorespiratory pathway in catalyzing the interconversion of serine and glycine with the conversion of tetrahydrofolate (THF) into 5,10-methylene-THF.	The photorespiratory Arabidopsis shm1 mutant is deficient in SHM1.2006 · DOI: 10.1104/pp.105.071399 The presequence of Arabidopsis serine hydroxymethyltransferase SHM2 selectively prevents import into mesophyll mitochondria.2011 · DOI: 10.1104/pp.111.184564

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032385 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0045453 bone resorption Biological Process

GO:0005829 cytosol Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

gga:419633

hsa:23154

mmu:26562

rno:89791

xla:494655

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.466

Rank 1 · TkA08G170740 · TK1151

Nucleus0.428

Rank 2 · TkA08G170740 · TK1151

Golgi apparatus0.110

Rank 3 · TkA08G170740 · TK1151

Endoplasmic reticulum0.098

Rank 4 · TkA08G170740 · TK1151

Cell membrane0.070

Rank 5 · TkA08G170740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05536Neurochondrin3-590 aa

PF08167RIX112-143 aa

PF01524Gemini_V2154-196 aa

PF08167RIX1167-227 aa

PF08167RIX1564-587 aa

PF01524Gemini_V2580-619 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G170740	`PF05536`	Neurochondrin	3	590	9.4e-126	421.3
TkA08G170740	`PF08167`	RIX1	12	143	0.069	13.6
TkA08G170740	`PF01524`	Gemini_V2	154	196	0.11	13.5
TkA08G170740	`PF08167`	RIX1	167	227	0.069	13.6
TkA08G170740	`PF08167`	RIX1	564	587	0.069	13.6
TkA08G170740	`PF01524`	Gemini_V2	580	619	0.11	13.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94JQ3`	Arabidopsis thaliana	sp\|Q94JQ3\|GLYP3_ARATH Serine hydroxymethyltransferase 3, chloroplastic	75.900%	Swiss-Prot	High
`Q9SZJ5`	Arabidopsis thaliana	sp\|Q9SZJ5\|GLYM1_ARATH Serine hydroxymethyltransferase 1, mitochondrial	62.400%	Swiss-Prot	High
`Q94C74`	Arabidopsis thaliana	sp\|Q94C74\|GLYM2_ARATH Serine hydroxymethyltransferase 2, mitochondrial	60.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card