TkA08G165320 | RubberDandelionOmics

Gene overview

TkA08G165320

Reference: TK1151 Chr: Chr08 Coordinates: 43180537-43181628 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

993 bp · TkA08G165320|TK1151|cDNA

CAAGATCATTGTGCGTGAAAAATGAAAGGGGCGTGAAAAATGAAAAATAAAGCCCAAACACTCATCCTATATTCCTATAATCCTATCCTCTCTGCCTTTCACTCTAACGAACATATCAGTATACCACTATATCGATGTCTTCACCCTCTCCCTCTGCGATAAATGTTCAGGTGCTTGTAGTAATCTTACTATTTTCCACCACTGCATTTGCGTTTGCATCATCGGAGGAGACGCCTAAGCCAACGCCATGGCCGGAGCAA...

CDS

Download CDS FASTA

600 bp · TkA08G165320|TK1151|CDS

ATGTCTTCACCCTCTCCCTCTGCGATAAATGTTCAGGTGCTTGTAGTAATCTTACTATTTTCCACCACTGCATTTGCGTTTGCATCATCGGAGGAGACGCCTAAGCCAACGCCATGGCCGGAGCAATTCCATTCAATTCTAGTCATGAACAACAGCGGCGAACTCCAATTGATAGATCTCTGGTACGACTGGCCCAACGGCCGTAACTTCAACATCATCCAGCATCAGCTCGGAAATATCCTCTACGACCTCGAATGGAA...

Protein

Download Protein FASTA

199 aa · TkA08G165320|TK1151|PROTEIN

MSSPSPSAINVQVLVVILLFSTTAFAFASSEETPKPTPWPEQFHSILVMNNSGELQLIDLWYDWPNGRNFNIIQHQLGNILYDLEWNNGTSFFYTLDSTRQCSSAQLEVGILRPNWLHGATYVGQRQVDGFPCYVWEKADFITYYEDVVTRRPVHWVFYTGRAAHVMTFEIGASLEDAKWQVPSYCFGKTTPVTGLVDM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G165320`
TK1151 ID	TkA08G165320
OH-1004 ID	LXL04_028320
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	58.600
Protein coverage (%)	TK1151 75.879 / OH-1004 76.768 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G165320

Location Chr08:43180537-43181628 (-)

Description Similar to At4g14100: Uncharacterized protein At4g14100

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14100`	Uncharacterized protein At4g14100.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028320 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000325 plant-type vacuole Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0099503 secretory vesicle Cellular Component

KEGG gene cross-reference

ath:AT4G14100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.575

Rank 1 · TkA08G165320 · TK1151

Cytoplasm0.157

Rank 2 · TkA08G165320 · TK1151

Endoplasmic reticulum0.148

Rank 3 · TkA08G165320 · TK1151

Extracellular0.124

Rank 4 · TkA08G165320 · TK1151

Golgi apparatus0.109

Rank 5 · TkA08G165320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25898LolA_2nd_metazoa32-63 aa

PF28435DUF839538-186 aa

PF25898LolA_2nd_metazoa120-138 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G165320	`PF25898`	LolA_2nd_metazoa	32	63	0.055	13.9
TkA08G165320	`PF28435`	DUF8395	38	186	5.1e-79	264.2
TkA08G165320	`PF25898`	LolA_2nd_metazoa	120	138	0.055	13.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q67YC9`	Arabidopsis thaliana	sp\|Q67YC9\|Y4141_ARATH Uncharacterized protein At4g14100	72.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card