TkA08G164140 | RubberDandelionOmics

Gene overview

TkA08G164140

Reference: TK1151 Chr: Chr08 Coordinates: 42875188-42879124 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2645 bp · TkA08G164140|TK1151|cDNA

AAAACACAATACAGGGTTCTAGGATTTTCCCCAAACTCTACAAGTACTTGTACTTTCCATTCCTCACGTGTTCAACACCCCCTCTTCGAAGTTCTCCGTCACGACGAATATTCCCCGGTCATAACTCCGACCAAGAGATTAAAAGAAAGCTACTTTTTAAGGCTGCCCGCTCTCCTTCTTGTTAAGATGTATGAAATAACTAATTTATCAGATAGCGAAGATGAGTTTAAACCTGATCCTGAAACCCTCACAAAAGTACA...

CDS

Download CDS FASTA

2397 bp · TkA08G164140|TK1151|CDS

AAAACACAATACAGGGTTCTAGGATTTTCCCCAAACTCTACAAGTACTTGTACTTTCCATTCCTCACGTGTTCAACACCCCCTCTTCGAAGTTCTCCGTCACGACGAATATTCCCCGGTCATAACTCCGACCAAGAGATTAAAAGAAAGCTACTTTTTAAGGCTGCCCGCTCTCCTTCTTGTTAAGATGTATGAAATAACTAATTTATCAGATAGCGAAGATGAGTTTAAACCTGATCCTGAAACCCTCACAAAAGTACA...

Protein

Download Protein FASTA

798 aa · TkA08G164140|TK1151|PROTEIN

KTQYRVLGFSPNSTSTCTFHSSRVQHPLFEVLRHDEYSPVITPTKRLKESYFLRLPALLLVKMYEITNLSDSEDEFKPDPETLTKVQAIDYFPCENMYSSHAGGNGASSSGSNIRSSLLGMGFQPDLIEKAIRQNGEDNMDLLLETLFAYSALQQSKPKSLHSINGSVVIKDEELAQSSGKRKALLISHSESSGSLDSLFGDEQDISSRNTNPTTISLKDDPDECCDGIDDKKASLLMMNFTIEEVEFAMSKLGEDAPIN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G164140`
TK1151 ID	TkA08G164140
OH-1004 ID	LXL04_023963
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	30.100
Protein coverage (%)	TK1151 90.476 / OH-1004 97.199 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G164140

Location Chr08:42875188-42879124 (+)

Description Similar to DRM2: DNA (cytosine-5)-methyltransferase DRM2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17310`	Catalytically inactive DNA methyltransferase that acts as regulatory factor for DRM2-mediated DNA methylation.	The de novo cytosine methyltransferase DRM2 requires intact UBA domains and a catalytically mutated paralog DRM3 during RNA-directed DNA methylation in Arabidopsis thaliana.2010 · DOI: 10.1371/journal.pgen.1001182 The cytological and molecular role of domains rearranged methyltransferase3 in RNA-dependent DNA methylation of Arabidopsis thaliana.2014 · DOI: 10.1186/1756-0500-7-721 Domains rearranged methyltransferase3 controls DNA methylation and regulates RNA polymerase V transcript abundance in Arabidopsis.2015 · DOI: 10.1073/pnas.1423603112
`UniProt: Q9M548`	Involved in de novo DNA methylation.	No verified direct reference in this release
`UniProt: Q9LXE5`	Involved in de novo DNA methylation.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0133900`	Involved in de novo DNA methylation.	No verified direct reference in this release
`Os03g0110800`	Involved in de novo DNA methylation.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023963 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006346 DNA methylation-dependent constitutive heterochromatin formation Biological Process

GO:0032259 methylation Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003886 DNA (cytosine-5-)-methyltransferase activity Molecular Function

GO:0008168 methyltransferase activity Molecular Function

GO:0009008 DNA-methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT5G14620

ath:AT5G15380

dosa:Os03g0110800

dosa:Os05g0133900

dosa:Os12g0108900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.886

Rank 1 · TkA08G164140 · TK1151

Cytoplasm0.168

Rank 2 · TkA08G164140 · TK1151

Cell membrane0.030

Rank 3 · TkA08G164140 · TK1151

Mitochondrion0.028

Rank 4 · TkA08G164140 · TK1151

Endoplasmic reticulum0.016

Rank 5 · TkA08G164140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22448RepB_primase_C118-135 aa

PF22567UBA_9119-149 aa

PF22567UBA_9239-268 aa

PF18039UBA_6241-262 aa

PF18039UBA_6296-323 aa

PF22448RepB_primase_C300-322 aa

PF22567UBA_9304-322 aa

PF22567UBA_9620-632 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G164140	`PF22448`	RepB_primase_C	118	135	0.056	14.1
TkA08G164140	`PF22567`	UBA_9	119	149	0.16	12.6
TkA08G164140	`PF22567`	UBA_9	239	268	0.16	12.6
TkA08G164140	`PF18039`	UBA_6	241	262	0.00076	20.2
TkA08G164140	`PF18039`	UBA_6	296	323	0.00076	20.2
TkA08G164140	`PF22448`	RepB_primase_C	300	322	0.056	14.1
TkA08G164140	`PF22567`	UBA_9	304	322	0.16	12.6
TkA08G164140	`PF22567`	UBA_9	620	632	0.16	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H1E8`	Arabidopsis thaliana	sp\|Q8H1E8\|DRM3_ARATH Probable inactive DNA (cytosine-5)-methyltransferase DRM3	38.700%	Swiss-Prot	Medium
`Q9M548`	Arabidopsis thaliana	sp\|Q9M548\|DRM2_ARATH DNA (cytosine-5)-methyltransferase DRM2	41.500%	Swiss-Prot	Low
`Q9LXE5`	Arabidopsis thaliana	sp\|Q9LXE5\|DRM1L_ARATH DNA (cytosine-5)-methyltransferase DRM1	40.800%	Swiss-Prot	Low
`Q6AUQ7`	Oryza sativa subsp. japonica	sp\|Q6AUQ7\|DRM3_ORYSJ Probable inactive DNA (cytosine-5)-methyltransferase DRM3	40.000%	Swiss-Prot	Medium
`Q10SU5`	Oryza sativa subsp. japonica	sp\|Q10SU5\|DRM2_ORYSJ DNA (cytosine-5)-methyltransferase DRM2	42.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card