TkA08G163730 | RubberDandelionOmics

Gene overview

TkA08G163730

Reference: TK1151 Chr: Chr08 Coordinates: 42727704-42731529 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2043 bp · TkA08G163730|TK1151|cDNA

TTTTAACTGGATATGAGGGCAGCTTTGTAACTTTTAAAATAAAAGGCAATTGAATGGACTTTCTCGAGGATTAGCAAAACAATCGGAAATCAGCCAACTGCTGAATTAAATGAGGGTCACGGAATTATAATTCTCAACATTCCCTTACCCAAACACATTTTCTAACAGAATTCATTTTCCATTTCCATCTAATTCATCCGGAAAGCTTGAAACAAACGCCCCCTTATTTTCTTCGACTTTTATTTCCATCAGGAATGTCA...

CDS

Download CDS FASTA

1329 bp · TkA08G163730|TK1151|CDS

ATGGAAGATTCTTCTGCGTTTGAAGATGTCTTTGTTTCGATTCCTCGCGGTGGTCCTATATACATCGCAGACATGGTTGGTCCACTCACTAGTGTTTCTCAATTCCAGTCATCCATTGAAGATGAACTCAAGGATCTGAAAAAGGAGGTGTGCATGGAATTGACTGAAGAACATCATCATGATATTTCGATTGATGAACTTAAAACCCTCACTGAGGATGAGTTGGTAGATATAGCATTCCAAGCATCATTCAAGGGTAG...

Protein

Download Protein FASTA

442 aa · TkA08G163730|TK1151|PROTEIN

MEDSSAFEDVFVSIPRGGPIYIADMVGPLTSVSQFQSSIEDELKDLKKEVCMELTEEHHHDISIDELKTLTEDELVDIAFQASFKGSNLTRDPSTSFEDCSEGILDNGQVSKKMKRVTQDEEDYMVEVEKLARIKQKQEEDKSSARLHSFSGKCGPVSCVTLTEKKERMSSFNSTSYLTQKVKSSSTREQIPVDDNEILLCIEVHNYNNRRSWFKTQEIMVLGRQLLTELKDKIYCLTDEIIKLKNKHSHSHSGYFLIED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G163730`
TK1151 ID	TkA08G163730
OH-1004 ID	LXL04_032288
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G163730

Location Chr08:42727704-42731529 (-)

Description Similar to SRD2: snRNA-activating protein complex subunit

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g28560`	Transcription activator of small-nuclear RNA genes (snRNA), which have essential roles in pre-mRNA splicing and rRNA processing.	Isolation of Temperature-Sensitive Mutants of Arabidopsis thaliana That Are Defective in the Redifferentiation of Shoots.1994 · DOI: 10.1104/pp.105.3.815 Protein tyrosine phosphorylation during phytohormone-stimulated cell proliferation in Arabidopsis Hypocotyls.2003 · DOI: 10.1093/pcp/pcg082 Involvement of SRD2-mediated activation of snRNA transcription in the control of cell proliferation competence in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02469.x Differential requirement for the function of SRD2, an snRNA transcription activator, in various stages of plant development.2008 · DOI: 10.1007/s11103-007-9271-7 Particular significance of SRD2-dependent snRNA accumulation in polarized pattern generation during lateral root development of Arabidopsis.2010 · DOI: 10.1093/pcp/pcq159 Organogenic responses in tissue culture of srd mutants of Arabidopsis thaliana.1998 · DOI: 10.1242/dev.125.1.135

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032288 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009301 snRNA transcription Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009926 auxin polar transport Biological Process

GO:0009942 longitudinal axis specification Biological Process

GO:0009945 radial axis specification Biological Process

GO:0010014 meristem initiation Biological Process

GO:0010311 lateral root formation Biological Process

GO:0042795 snRNA transcription by RNA polymerase II Biological Process

GO:0042796 snRNA transcription by RNA polymerase III Biological Process

GO:0043697 cell dedifferentiation Biological Process

GO:0060184 cell cycle switching Biological Process

GO:0071365 cellular response to auxin stimulus Biological Process

KEGG gene cross-reference

ath:AT1G28560

mcf:101865660

mmu:77634

rno:362537

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.803

Rank 1 · TkA08G163730 · TK1151

Cytoplasm0.239

Rank 2 · TkA08G163730 · TK1151

Mitochondrion0.053

Rank 3 · TkA08G163730 · TK1151

Cell membrane0.032

Rank 4 · TkA08G163730 · TK1151

Golgi apparatus0.018

Rank 5 · TkA08G163730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04344CheZ108-148 aa

PF12251SNAPC3217-440 aa

PF04344CheZ270-306 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G163730	`PF04344`	CheZ	108	148	0.16	12.6
TkA08G163730	`PF12251`	SNAPC3	217	440	1.3e-67	228.1
TkA08G163730	`PF04344`	CheZ	270	306	0.16	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L627`	Arabidopsis thaliana	sp\|Q8L627\|SRD2_ARATH snRNA-activating protein complex subunit	52.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card