TkA08G158250 | RubberDandelionOmics

Gene overview

TkA08G158250

Reference: TK1151 Chr: Chr08 Coordinates: 41185968-41186483 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

516 bp · TkA08G158250|TK1151|cDNA

ATGCTCAAATTTGTGATGTTAACAGTCAATTTCGCATCTCTTCTTCTTCATCTACATCTCGTCTGCGTTCTCGCCACCGATGACGGGTCTGAAAACGGATTCGGTGGGTGTAATTGCGAAGTCGAAGGGTTCTTCGGGTACAGAAACATCATGGAAACGCAAAGAGTAAGCGATTTTTTAATCGCGGTCGCTTATTTCTCAATTCCAATCGAGCTTCTTTACTTCGTAAGTTGTTCAAATGTTCCTTTCAAATGGGTCCT...

CDS

Download CDS FASTA

516 bp · TkA08G158250|TK1151|CDS

ATGCTCAAATTTGTGATGTTAACAGTCAATTTCGCATCTCTTCTTCTTCATCTACATCTCGTCTGCGTTCTCGCCACCGATGACGGGTCTGAAAACGGATTCGGTGGGTGTAATTGCGAAGTCGAAGGGTTCTTCGGGTACAGAAACATCATGGAAACGCAAAGAGTAAGCGATTTTTTAATCGCGGTCGCTTATTTCTCAATTCCAATCGAGCTTCTTTACTTCGTAAGTTGTTCAAATGTTCCTTTCAAATGGGTCCT...

Protein

Download Protein FASTA

171 aa · TkA08G158250|TK1151|PROTEIN

MLKFVMLTVNFASLLLHLHLVCVLATDDGSENGFGGCNCEVEGFFGYRNIMETQRVSDFLIAVAYFSIPIELLYFVSCSNVPFKWVLFQFIAFIVLCGMTHLLNGYVDLRTAPFSANARAHHFQVPYNYGFLRNCHNFSHSHPFASESEVREFMLKKKTWDLGVEMGLMLM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G158250`
TK1151 ID	TkA08G158250
OH-1004 ID	LXL04_001968
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G158250

Location Chr08:41185968-41186483 (+)

Description Similar to ETR2: Ethylene receptor 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g23150`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release
`At3g04580`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release
`At1g04310`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q8H1X1`	Ethylene receptor related to bacterial two-component regulators.	No verified direct reference in this release
`Os04g0169100`	Ethylene receptor related to bacterial two-component regulators.	The ethylene receptor ETR2 delays floral transition and affects starch accumulation in rice.2009 · DOI: 10.1105/tpc.108.065391

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001968 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009723 response to ethylene Biological Process

GO:0010105 negative regulation of ethylene-activated signaling pathway Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:2000904 regulation of starch metabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0000155 phosphorelay sensor kinase activity Molecular Function

GO:0004673 protein histidine kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G04310

ath:AT3G04580

ath:AT3G23150

dosa:Os04g0169100

sly:606298

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.505

Rank 1 · TkA08G158250 · TK1151

Golgi apparatus0.209

Rank 2 · TkA08G158250 · TK1151

Nucleus0.173

Rank 3 · TkA08G158250 · TK1151

Cytoplasm0.149

Rank 4 · TkA08G158250 · TK1151

Cell membrane0.110

Rank 5 · TkA08G158250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07519Tannase31-80 aa

PF25487ETR1_N50-108 aa

PF07497Rho_RNA_bind126-157 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G158250	`PF07519`	Tannase	31	80	0.2	11.3
TkA08G158250	`PF25487`	ETR1_N	50	108	3.7e-27	95.6
TkA08G158250	`PF07497`	Rho_RNA_bind	126	157	0.35	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WPQ2`	Arabidopsis thaliana	sp\|Q0WPQ2\|ETR2_ARATH Ethylene receptor 2	54.500%	Swiss-Prot	High
`Q9ZTP3`	Arabidopsis thaliana	sp\|Q9ZTP3\|EIN4_ARATH Protein EIN4	47.800%	Swiss-Prot	Medium
`P93825`	Arabidopsis thaliana	sp\|P93825\|ERS2_ARATH Ethylene response sensor 2	45.800%	Swiss-Prot	Medium
`Q8H1X1`	Oryza sativa subsp. indica	sp\|Q8H1X1\|ETR2_ORYSI Ethylene receptor 2	57.100%	Swiss-Prot	Low
`Q7XX84`	Oryza sativa subsp. japonica	sp\|Q7XX84\|ETR2_ORYSJ Ethylene receptor 2	57.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card