TkA08G152000 | RubberDandelionOmics

Gene overview

TkA08G152000

Reference: TK1151 Chr: Chr08 Coordinates: 39661567-39662297 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

588 bp · TkA08G152000|TK1151|cDNA

ATGGCGTCTTCCCTCCGCCTTCATCTGCCATTCCGCTCTCCCGGCCACCATTCCCCCGCCGTTCACCCCGTCGGGAATTCTATACGCTACACCACAGTCCGATGTGGTCCAAGAGACAACCGTGGTCCGCTATACAAAGGCCGAACGCTTAGCATAGAGGCAATTCAAGCCGTGCAAACACTCAAACGATCACACCGTTCAGATCCAACCAATAACGACACCGTTTCCAAAACGCTATCCCGCCTCGTGAAATCCGACCT...

CDS

Download CDS FASTA

588 bp · TkA08G152000|TK1151|CDS

ATGGCGTCTTCCCTCCGCCTTCATCTGCCATTCCGCTCTCCCGGCCACCATTCCCCCGCCGTTCACCCCGTCGGGAATTCTATACGCTACACCACAGTCCGATGTGGTCCAAGAGACAACCGTGGTCCGCTATACAAAGGCCGAACGCTTAGCATAGAGGCAATTCAAGCCGTGCAAACACTCAAACGATCACACCGTTCAGATCCAACCAATAACGACACCGTTTCCAAAACGCTATCCCGCCTCGTGAAATCCGACCT...

Protein

Download Protein FASTA

195 aa · TkA08G152000|TK1151|PROTEIN

MASSLRLHLPFRSPGHHSPAVHPVGNSIRYTTVRCGPRDNRGPLYKGRTLSIEAIQAVQTLKRSHRSDPTNNDTVSKTLSRLVKSDLVASFNELLRQDQFELALKVFSAIRSEDWYKTDLSLYAKLVTSMASRKMTEDIDRLILDVEPEDVISSDSKGLITLIKALLAADRAESTGVGWHSGKDDGVNCKIVMEK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G152000`
TK1151 ID	TkA08G152000
OH-1004 ID	LXL04_032134
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	93.100
Protein coverage (%)	TK1151 96.923 / OH-1004 80.769 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G152000

Location Chr08:39661567-39662297 (-)

Description Similar to THA8: Protein THYLAKOID ASSEMBLY 8, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g27750`	Essential protein required during embryogenesis.	A short PPR protein required for the splicing of specific group II introns in angiosperm chloroplasts.2012 · DOI: 10.1261/rna.032623.112 Structure of a PLS-class pentatricopeptide repeat protein provides insights into mechanism of RNA recognition.2013 · DOI: 10.1074/jbc.m113.496828

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032134 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000373 Group II intron splicing Biological Process

GO:0006397 mRNA processing Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003727 single-stranded RNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:1990825 sequence-specific mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G62350

ath:AT3G27750

ath:AT3G46870

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.908

Rank 1 · TkA08G152000 · TK1151

Mitochondrion0.064

Rank 2 · TkA08G152000 · TK1151

Nucleus0.055

Rank 3 · TkA08G152000 · TK1151

Cytoplasm0.021

Rank 4 · TkA08G152000 · TK1151

Cell membrane0.011

Rank 5 · TkA08G152000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11105CCAP51-111 aa

PF11105CCAP133-158 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G152000	`PF11105`	CCAP	51	111	0.048	14.3
TkA08G152000	`PF11105`	CCAP	133	158	0.048	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVW6`	Arabidopsis thaliana	sp\|Q9LVW6\|THA8_ARATH Protein THYLAKOID ASSEMBLY 8, chloroplastic	45.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card