TkA08G151070 | RubberDandelionOmics

Gene overview

TkA08G151070

Reference: TK1151 Chr: Chr08 Coordinates: 39344361-39348470 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1698 bp · TkA08G151070|TK1151|cDNA

ACATATGTCATAAACGATCAATTTATTGGACAGTTGGCAGTGGTCAATATACATTTAACAATGACCCCAAAAATCGAATAGAAAGATAACTTCAAACCTCCCTCTACATCTCCCACTCACTCCCACTGTGGGGAGAACCCCAGAGCAGCTAATCTGATCTTAAACTATGGCGGTGGTTATGCATGTTTTGAACCAGCCAACGAAGCCTTTAATCACGTCGTCTTCGCCTTCAATCTCCGCCGCACATGACCGGAATTTCA...

CDS

Download CDS FASTA

1350 bp · TkA08G151070|TK1151|CDS

ATGGCGGTGGTTATGCATGTTTTGAACCAGCCAACGAAGCCTTTAATCACGTCGTCTTCGCCTTCAATCTCCGCCGCACATGACCGGAATTTCAGCTATTATGCTCATGTATCCAGCAGGTACCATCCGCTTCCGAGTACAAGTACCACCACTAGCAACAGCAGCAGCTGCAGATTGCATCGCATCACTTCTCAATTGCCCCTAAATTCATCGAAAACAGGTTATGGATATTCATGGATGCAAGACAACTCAAGCTATAA...

Protein

Download Protein FASTA

449 aa · TkA08G151070|TK1151|PROTEIN

MAVVMHVLNQPTKPLITSSSPSISAAHDRNFSYYAHVSSRYHPLPSTSTTTSNSSSCRLHRITSQLPLNSSKTGYGYSWMQDNSSYKSLIANNERTHGPINSAFPSTPAQVSSVEDLFEFICSGPLIEKLGFTPETIGESIDKWLTNGFHVCELFNLNELYLTIPQKARIYHYYIPVFLWCEQQISDHRAAFKDGDDIPPLVIGFSAPQGCGKTTLVFALDYLFSKTSGRKSATISIDDFYLPYDEQAKLREKNPGNALL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G151070`
TK1151 ID	TkA08G151070
OH-1004 ID	LXL04_032113
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	93.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G151070

Location Chr08:39344361-39348470 (+)

Description Similar to GLYK: D-glycerate 3-kinase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80380`	Catalyzes the concluding reaction of the photorespiratory C2 cycle, an indispensable ancillary metabolic pathway to the photosynthetic C3 cycle that enables land plants to grow in an oxygen- containing atmosphere.	D-GLYCERATE 3-KINASE, the last unknown enzyme in the photorespiratory cycle in Arabidopsis, belongs to a novel kinase family.2005 · DOI: 10.1105/tpc.105.033993 Light Controls Protein Localization through Phytochrome-Mediated Alternative Promoter Selection.2017 · DOI: 10.1016/j.cell.2017.10.018

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032113 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009853 photorespiration Biological Process

GO:0009854 oxidative photosynthetic carbon pathway Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0008887 glycerate kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G80380

sce:YGR205W

spo:2543381

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.973

Rank 1 · TkA08G151070 · TK1151

Mitochondrion0.045

Rank 2 · TkA08G151070 · TK1151

Cytoplasm0.039

Rank 3 · TkA08G151070 · TK1151

Peroxisome0.025

Rank 4 · TkA08G151070 · TK1151

Nucleus0.022

Rank 5 · TkA08G151070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00485PRK202-328 aa

PF13476AAA_23204-239 aa

PF00485PRK382-418 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G151070	`PF00485`	PRK	202	328	0.00017	22.2
TkA08G151070	`PF13476`	AAA_23	204	239	0.25	12.7
TkA08G151070	`PF00485`	PRK	382	418	0.00017	22.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q944I4`	Arabidopsis thaliana	sp\|Q944I4\|GLYK_ARATH D-glycerate 3-kinase, chloroplastic	70.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card