TkA08G146600 | RubberDandelionOmics

Gene overview

TkA08G146600

Reference: TK1151 Chr: Chr08 Coordinates: 38235382-38241570 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1113 bp · TkA08G146600|TK1151|cDNA

GAAACGTGTTGTACTTGGTTTATATTCCATTTGTAACACCACCATACTCACATGGGATTCTCCGCCACTGTCCTCCGCCTACAAATAGCCCATCACACTAAGTACTTCTCCTCCACCACCGTTCTTCAATTCACTACTAAAATGAACGGCAACACCCACCGCTCCCCACTCCACAACAACCCCGGCCACCTCAAAAACCACTCACTTGCTAAGTCTAGTCTCAAAAACGACCGCCGGAGCTGGGTTGATGAGATACGGTG...

CDS

Download CDS FASTA

945 bp · TkA08G146600|TK1151|CDS

ATGGGATTCTCCGCCACTGTCCTCCGCCTACAAATAGCCCATCACACTAAGTACTTCTCCTCCACCACCGTTCTTCAATTCACTACTAAAATGAACGGCAACACCCACCGCTCCCCACTCCACAACAACCCCGGCCACCTCAAAAACCACTCACTTGCTAAGTCTAGTCTCAAAAACGACCGCCGGAGCTGGGTTGATGAGATACGGTGGCGGGTTGGTGAGGCGTCGTGCATGAAATGGACGGCGGATGATGTGTTGGC...

Protein

Download Protein FASTA

314 aa · TkA08G146600|TK1151|PROTEIN

MGFSATVLRLQIAHHTKYFSSTTVLQFTTKMNGNTHRSPLHNNPGHLKNHSLAKSSLKNDRRSWVDEIRWRVGEASCMKWTADDVLAVVKYHPIPCLLAVALLFFMGVEYTLLMIPPSSPPFDIGFMATVNLHRILAGSPALNTILAGLNTVFVGMQTAYIIGTWVVEGRPRATIAALLMFTFRGILGYSTQLPLPQEFLGSGADFPVGNVSFFLFYSGHVAASVIASLDMRRMQRLKSAILFDILNVLQFVRLLSSRGH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G146600`
TK1151 ID	TkA08G146600
OH-1004 ID	LXL04_032065
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	74.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G146600

Location Chr08:38235382-38241570 (+)

Description Similar to ROD1: Phosphatidylcholine:diacylglycerol cholinephosphotransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g15820`	Functions as a phosphatidylcholine:diacylglycerol cholinephosphotransferase that catalyzes the transfer of the phosphocholine headgroup from phosphatidylcholine (PC) to diacylglycerol, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway.	An enzyme regulating triacylglycerol composition is encoded by the ROD1 gene of Arabidopsis.2009 · DOI: 10.1073/pnas.0908848106 Acyl editing and headgroup exchange are the major mechanisms that direct polyunsaturated fatty acid flux into triacylglycerols.2012 · DOI: 10.1104/pp.112.204438
`At3g15830`	Functions as a phosphatidylcholine:diacylglycerol cholinephosphotransferase that catalyzes the transfer of the phosphocholine headgroup from phosphatidylcholine (PC) to diacylglycerol, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032065 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0046470 phosphatidylcholine metabolic process Biological Process

GO:0016020 membrane Cellular Component

GO:0004142 diacylglycerol cholinephosphotransferase activity Molecular Function

KEGG gene cross-reference

ath:AT3G15820

ath:AT3G15830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.453

Rank 1 · TkA08G146600 · TK1151

Golgi apparatus0.344

Rank 2 · TkA08G146600 · TK1151

Nucleus0.097

Rank 3 · TkA08G146600 · TK1151

Cytoplasm0.079

Rank 4 · TkA08G146600 · TK1151

Cell membrane0.067

Rank 5 · TkA08G146600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24788AtPDCT1_263-95 aa

PF24788AtPDCT1_2122-281 aa

PF14378PAP2_3128-196 aa

PF27338CbsB175-251 aa

PF14360PAP2_C215-274 aa

PF14378PAP2_3218-269 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G146600	`PF24788`	AtPDCT1_2	63	95	5.1e-87	290.4
TkA08G146600	`PF24788`	AtPDCT1_2	122	281	5.1e-87	290.4
TkA08G146600	`PF14378`	PAP2_3	128	196	0.054	13.9
TkA08G146600	`PF27338`	CbsB	175	251	0.028	14.5
TkA08G146600	`PF14360`	PAP2_C	215	274	0.00011	23.4
TkA08G146600	`PF14378`	PAP2_3	218	269	0.054	13.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVZ7`	Arabidopsis thaliana	sp\|Q9LVZ7\|PDCT1_ARATH Phosphatidylcholine:diacylglycerol cholinephosphotransferase 1	72.300%	Swiss-Prot	Medium
`Q9LVZ6`	Arabidopsis thaliana	sp\|Q9LVZ6\|PDCT2_ARATH Phosphatidylcholine:diacylglycerol cholinephosphotransferase 2	70.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card