TkA08G146140 | RubberDandelionOmics

Gene overview

TkA08G146140

Reference: TK1151 Chr: Chr08 Coordinates: 38106665-38109344 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1626 bp · TkA08G146140|TK1151|cDNA

GTCTAAAGTGGTATCATCTGATCGAAATTGAGCCGTTGTGACTTGGGAGTTTGGGACTTGGTATTCATGTTTCTTGTAAAAACTAAAACAGTAAAACCTAAGGCTTACTAGAGAGCTCTGCTACAAAAAAAAACGCGCCAAACTCGTTAACAATGCCGGAGCTTCCAGAGGTGGAAGCTGCTCGAAGAGCCATTGAAGAAAACTGTCTCGGTAAGAAGATTAAGCGGTCTGTGGTTGCCGATGATTCTAAAGTCGTCGAC...

CDS

Download CDS FASTA

798 bp · TkA08G146140|TK1151|CDS

ATGCCGGAGCTTCCAGAGGTGGAAGCTGCTCGAAGAGCCATTGAAGAAAACTGTCTCGGTAAGAAGATTAAGCGGTCTGTGGTTGCCGATGATTCTAAAGTCGTCGACGGCGTTTCACCTTCCGACTTTGAAGCCGCTCTCACCGGAAAAACAATTGTCGCCGCTCACCGCAAGGGGAAGAATATGTGGATCCAGCTCGATTCTCCTCCTTTTCCGTCCTTCCAGTTTGGAATGGCAGGTGCTATATATATCAAAGGTGT...

Protein

Download Protein FASTA

265 aa · TkA08G146140|TK1151|PROTEIN

MPELPEVEAARRAIEENCLGKKIKRSVVADDSKVVDGVSPSDFEAALTGKTIVAAHRKGKNMWIQLDSPPFPSFQFGMAGAIYIKGVAVTKYKRSAVNDTDEWPSKYSKLFIELDDGLELSFTDKRRFAKVRLLQNPASAPPISELGPDALLEPMTEDELFKSLSKKKTAIKALILDQGFISGVGNWIADEVLYQARIHPLQSAASISKEQCGALHKSLKEVIYHSVKVNADSSRFPDDWLFHLRWGKKLGEINGEKVFY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G146140`
TK1151 ID	TkA08G146140
OH-1004 ID	LXL04_032058
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.200
Protein coverage (%)	TK1151 97.358 / OH-1004 58.636 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G146140

Location Chr08:38106665-38109344 (+)

Description Similar to FPG1: Formamidopyrimidine-DNA glycosylase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g52500`	Involved in base excision repair of DNA damaged by oxidation or by mutagenic agents.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032058 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006284 base-excision repair Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0005634 nucleus Cellular Component

GO:0003684 damaged DNA binding Molecular Function

GO:0003690 double-stranded DNA binding Molecular Function

GO:0003906 DNA-(apurinic or apyrimidinic site) endonuclease activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0008534 oxidized purine nucleobase lesion DNA N-glycosylase activity Molecular Function

GO:0019104 DNA N-glycosylase activity Molecular Function

GO:0034039 8-oxo-7,8-dihydroguanine DNA N-glycosylase activity Molecular Function

GO:0140078 class I DNA-(apurinic or apyrimidinic site) endonuclease activity Molecular Function

KEGG gene cross-reference

ath:AT1G52500

cau:Caur_1873

pth:PTH_1977

rca:Rcas_3836

rrs:RoseRS_1946

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.571

Rank 1 · TkA08G146140 · TK1151

Nucleus0.295

Rank 2 · TkA08G146140 · TK1151

Mitochondrion0.146

Rank 3 · TkA08G146140 · TK1151

Cell membrane0.063

Rank 4 · TkA08G146140 · TK1151

Plastid0.059

Rank 5 · TkA08G146140 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01149Fapy_DNA_glyco1-131 aa

PF26095CC_Bre1131-221 aa

PF06831H2TH146-236 aa

PF05833NFACT_N155-223 aa

PF21672COMM_HN195-236 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G146140	`PF01149`	Fapy_DNA_glyco	1	131	7.8e-31	107.9
TkA08G146140	`PF26095`	CC_Bre1	131	221	0.31	12.1
TkA08G146140	`PF06831`	H2TH	146	236	4.8e-29	100.9
TkA08G146140	`PF05833`	NFACT_N	155	223	0.0089	15.6
TkA08G146140	`PF21672`	COMM_HN	195	236	0.037	15.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80358`	Arabidopsis thaliana	sp\|O80358\|FPG_ARATH Formamidopyrimidine-DNA glycosylase	75.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card