TkA08G142980 | RubberDandelionOmics

Gene overview

TkA08G142980

Reference: TK1151 Chr: Chr08 Coordinates: 37245242-37248201 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1875 bp · TkA08G142980|TK1151|cDNA

TTTTATTCATACAAATTGCTGTATCATAACATTTTTATATTTTCATCCGAGTTTTTTTTGATTTTATACTTTCACATATATGTAGGAGAGAGAGAGAGAGAGAAAGAGAGAGGGATTCAAAATTCAAAGCATGAAACCATGACAGACAAAACACAGGAAATTTGGGAAGATCCTCCAATCTTAGCTTTCCTTCGCTTCTTTTGTCTCCCCCTTCCTCTTCTAAGCAACTATTTCGGCATCAAAATGGCGTTGAATCTTCT...

CDS

Download CDS FASTA

1584 bp · TkA08G142980|TK1151|CDS

TTTTATTCATACAAATTGCTGTATCATAACATTTTTATATTTTCATCCGAGTTTTTTTTGATTTTATACTTTCACATATATGTAGGAGAGAGAGAGAGAGAGAAAGAGAGAGGGATTCAAAATTCAAAGCATGAAACCATGACAGACAAAACACAGGAAATTTGGGAAGATCCTCCAATCTTAGCTTTCCTTCGCTTCTTTTGTCTCCCCCTTCCTCTTCTAAGCAACTATTTCGGCATCAAAATGGCGTTGAATCTTCT...

Protein

Download Protein FASTA

527 aa · TkA08G142980|TK1151|PROTEIN

FYSYKLLYHNIFIFSSEFFLILYFHIYVGEREREKERGIQNSKHETMTDKTQEIWEDPPILAFLRFFCLPLPLLSNYFGIKMALNLLFIIPILVLCSFTLPVDAFTASPPLSSMADPVLPNEKKPPFSHIPTDNEARSPGVSEIRVVHHEDLNKKILIALIVASSLLAAILLFLSCFWIYRLKISKTSKTQKAQQSQDASKGLSLGPILDKFNPLRMAGKKGSVTVIEYEWLVSATNNFHEDNIIGHGAFGSVYKACFND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G142980`
TK1151 ID	TkA08G142980
OH-1004 ID	LXL04_032031
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 91.271 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G142980

Location Chr08:37245242-37248201 (-)

Description Similar to At1g80640: Probable receptor-like protein kinase At1g80640

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80640`	Probable receptor-like protein kinase At1g80640.	No verified direct reference in this release
`At1g07870`	May be involved in plant defense signaling.	No verified direct reference in this release
`At3g24790`	May be involved in plant defense signaling.	No verified direct reference in this release
`At4g13190`	May be involved in plant defense signaling.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0372100`	Functions as an immediate downstream signaling partner of CERK1 in the microbial peptidoglycans (PGNs) and fungal chitin signaling pathways that mediate innate immunity.	A receptor-like cytoplasmic kinase targeted by a plant pathogen effector is directly phosphorylated by the chitin receptor and mediates rice immunity.2013 · DOI: 10.1016/j.chom.2013.02.007

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032031 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002758 innate immune response-activating signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0031349 positive regulation of defense response Biological Process

GO:0045087 innate immune response Biological Process

GO:0045088 regulation of innate immune response Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

KEGG gene cross-reference

ath:AT1G07870

ath:AT1G80640

ath:AT3G20530

ath:AT3G24790

dosa:Os05g0372100

osa:4338592

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.772

Rank 1 · TkA08G142980 · TK1151

Endoplasmic reticulum0.113

Rank 2 · TkA08G142980 · TK1151

Cytoplasm0.113

Rank 3 · TkA08G142980 · TK1151

Nucleus0.089

Rank 4 · TkA08G142980 · TK1151

Lysosome / Vacuole0.039

Rank 5 · TkA08G142980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06365CD34_antigen144-192 aa

PF00069Pkinase239-455 aa

PF07714PK_Tyr_Ser-Thr242-475 aa

PF12260PIP49_C293-383 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G142980	`PF06365`	CD34_antigen	144	192	0.12	13.1
TkA08G142980	`PF00069`	Pkinase	239	455	6.3e-44	151.1
TkA08G142980	`PF07714`	PK_Tyr_Ser-Thr	242	475	5.9e-47	160.9
TkA08G142980	`PF12260`	PIP49_C	293	383	0.056	13.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0V7T5`	Arabidopsis thaliana	sp\|Q0V7T5\|Y1864_ARATH Probable receptor-like protein kinase At1g80640	57.400%	Swiss-Prot	High
`Q9LQQ8`	Arabidopsis thaliana	sp\|Q9LQQ8\|PBL5_ARATH Probable serine/threonine-protein kinase PBL5	45.800%	Swiss-Prot	Medium
`Q9LRY1`	Arabidopsis thaliana	sp\|Q9LRY1\|PBL25_ARATH Probable serine/threonine-protein kinase PBL25	48.400%	Swiss-Prot	Medium
`Q1PE89`	Arabidopsis thaliana	sp\|Q1PE89\|PBL24_ARATH Probable serine/threonine-protein kinase PBL24	44.600%	Swiss-Prot	Medium
`Q6I5Q6`	Oryza sativa subsp. japonica	sp\|Q6I5Q6\|RK185_ORYSJ Receptor-like cytoplasmic kinase 185	46.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card