Gene Card
Gene overview
cDNA / CDS / Protein Sequences
4191 bp · TkA08G141990|TK1151|cDNA
ATGTATTTACAGTATGCATCAAAAAATTGTCAAACAACTCATTTACATAATGATTCCAGCGTGATGCCTACCGTAAACTACAACCTTCAACCAATCTCCTTACCCAACATAGAGAATTCTACATTCTCGTATGGTACGACATCTAGGAATTCATCTGCAAATTTTAACATACGATCTAATGAAGAATTACGCGAACAACAAAATATCGACAATTCAATATCAGGTGTCTCACGAGAGTATGTTGATCATGGTGATCAGAC...
4191 bp · TkA08G141990|TK1151|CDS
ATGTATTTACAGTATGCATCAAAAAATTGTCAAACAACTCATTTACATAATGATTCCAGCGTGATGCCTACCGTAAACTACAACCTTCAACCAATCTCCTTACCCAACATAGAGAATTCTACATTCTCGTATGGTACGACATCTAGGAATTCATCTGCAAATTTTAACATACGATCTAATGAAGAATTACGCGAACAACAAAATATCGACAATTCAATATCAGGTGTCTCACGAGAGTATGTTGATCATGGTGATCAGAC...
Protein
Download Protein FASTA1396 aa · TkA08G141990|TK1151|PROTEIN
MYLQYASKNCQTTHLHNDSSVMPTVNYNLQPISLPNIENSTFSYGTTSRNSSANFNIRSNEELREQQNIDNSISGVSREYVDHGDQTHECKICHATLWKAETLRGNKSQKKKSFSMCCANGKVQLPDMKEAPTYYQDLFRSNDAKSKFFLKNIRRFNSMFSFTSMGGIVDNSVNSGNAPYVYRISGQNYHCLGSLLPVDGSTAKFSQLYIYDTENEVSNRQDAFRKNSQQSSSTSNLIDTEIINYLKTTFDSTNELVKSY...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G141990 |
|---|---|
| TK1151 ID | TkA08G141990 |
| OH-1004 ID | LXL04_005692 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 90.600 |
| Protein coverage (%) | TK1151 76.146 / OH-1004 72.150Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G141990 |
|---|---|
| Location | Chr08:37028383-37033405 (-) |
| Description | Similar to pif1: ATP-dependent DNA helicase pif1 (Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIB 9529 / HD100) |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000723 telomere maintenance Biological Process GO:0001117 protein-DNA-RNA complex disassembly Biological Process GO:0006281 DNA repair Biological Process GO:0006310 DNA recombination Biological Process GO:0032211 negative regulation of telomere maintenance via telomerase Biological Process GO:0051276 chromosome organization Biological Process GO:0000781 chromosome, telomeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0031981 nuclear lumen Cellular Component |
| KEGG gene cross-reference | bba:Bd3546 cje:Cj0945c rno:367645 tbr:Tb11.01.6420 xla:734585 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF14214Helitron_like_N341-514 aaPF23343REP_ORF2-G2P478-620 aaPF20199RepSA500-644 aaPF14214Helitron_like_N885-919 aaPF25199nSTAND_NTPase5908-969 aaPF05970PIF1916-1133 aaPF13191AAA_16925-965 aaPF13604AAA_30927-1036 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G141990 | PF14214 | Helitron_like_N | 341 | 514 | 5.8e-54 | 183.9 |
| TkA08G141990 | PF23343 | REP_ORF2-G2P | 478 | 620 | 5.9e-05 | 24.0 |
| TkA08G141990 | PF20199 | RepSA | 500 | 644 | 0.055 | 13.3 |
| TkA08G141990 | PF14214 | Helitron_like_N | 885 | 919 | 5.8e-54 | 183.9 |
| TkA08G141990 | PF25199 | nSTAND_NTPase5 | 908 | 969 | 0.13 | 12.8 |
| TkA08G141990 | PF05970 | PIF1 | 916 | 1133 | 5.6e-91 | 304.8 |
| TkA08G141990 | PF13191 | AAA_16 | 925 | 965 | 0.029 | 15.6 |
| TkA08G141990 | PF13604 | AAA_30 | 927 | 1036 | 6.6e-06 | 26.7 |
| TkA08G141990 | PF10923 | BrxC_BrxD | 927 | 973 | 0.1 | 12.3 |
| TkA08G141990 | PF13481 | AAA_25 | 935 | 990 | 0.1 | 12.9 |
| TkA08G141990 | PF25199 | nSTAND_NTPase5 | 1009 | 1038 | 0.13 | 12.8 |
| TkA08G141990 | PF21530 | Pif1_2B_dom | 1235 | 1279 | 2.3e-19 | 69.5 |
| TkA08G141990 | PF02689 | Herpes_Helicase | 1326 | 1370 | 0.0001 | 21.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.