TkA08G137400 | RubberDandelionOmics

Gene overview

TkA08G137400

Reference: TK1151 Chr: Chr08 Coordinates: 35732515-35734321 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

920 bp · TkA08G137400|TK1151|cDNA

GATAGTTTTAAATCATAATAAAATTACAAAATAAAAACCACAATTAATTACAAAAAATAATTGTACGTTTGCACAAAATCCAAAACTTCCCCTTCCCGGGTAGCATTTCCGCGCGAGTAAAATTTCAATCTGGCCTCTCCCATTCCCATCCTCCGACGCCGACGGCGCAAAAATCAACCGTCGCTAGCGGCGCCATGGATGGTCCTGCAGCACCCTCGAAGAAATCCGACGGTGCTTCCAAGTTCCTTGCTGATCTTCCC...

CDS

Download CDS FASTA

522 bp · TkA08G137400|TK1151|CDS

ATGGATGGTCCTGCAGCACCCTCGAAGAAATCCGACGGTGCTTCCAAGTTCCTTGCTGATCTTCCCTCCAAAGGCCTTTTCTCATCCTCCGTCATTTCTTCCAATTTGGGTGGAATGCGAGTCTATATAACTGATCATGACACAACACCTCCAGAAAACCAGCTTATAAAAACCGATCAAGTCAACATTCTGATCAGATCACTTCTCCTAAAACAACAGAAATCTGGAACAACTTCAAAGAACACAAAGGGTGCACATGA...

Protein

Download Protein FASTA

173 aa · TkA08G137400|TK1151|PROTEIN

MDGPAAPSKKSDGASKFLADLPSKGLFSSSVISSNLGGMRVYITDHDTTPPENQLIKTDQVNILIRSLLLKQQKSGTTSKNTKGAHENSRKRAPERTADGRASAKRAASTSQNGSRQDVLKSQIPENLQSLTVERLRALLKERSLSVKGKKDELIARLRSTIGSASSSAVKPH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G137400`
TK1151 ID	TkA08G137400
OH-1004 ID	LXL04_031936
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G137400

Location Chr08:35732515-35734321 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63460`	Supports abscisic acid (ABA) responses and drought tolerance by regulating the dynamic localization and stability (preventing degradation by the proteasome) of CAR proteins (C2-domain ABA-related, e.g. CAR9).	LOWER TEMPERATURE 1 Enhances ABA Responses and Plant Drought Tolerance by Modulating the Stability and Localization of C2-Domain ABA-Related Proteins in Arabidopsis.2019 · DOI: 10.1016/j.molp.2019.05.002

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031936 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0031647 regulation of protein stability Biological Process

GO:0032434 regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:1902584 positive regulation of response to water deprivation Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.913

Rank 1 · TkA08G137400 · TK1151

Cytoplasm0.186

Rank 2 · TkA08G137400 · TK1151

Mitochondrion0.024

Rank 3 · TkA08G137400 · TK1151

Cell membrane0.022

Rank 4 · TkA08G137400 · TK1151

Endoplasmic reticulum0.011

Rank 5 · TkA08G137400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10172DDA116-73 aa

PF08687ASD265-162 aa

PF07763FEZ103-158 aa

PF13297SDE2_2C105-164 aa

PF02037SAP128-159 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G137400	`PF10172`	DDA1	16	73	2e-14	54.2
TkA08G137400	`PF08687`	ASD2	65	162	0.017	15.5
TkA08G137400	`PF07763`	FEZ	103	158	0.092	13.2
TkA08G137400	`PF13297`	SDE2_2C	105	164	0.025	15.2
TkA08G137400	`PF02037`	SAP	128	159	1.6e-10	41.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6IDA6`	Arabidopsis thaliana	sp\|Q6IDA6\|LOT1_ARATH Protein LOWER TEMPERATURE 1	61.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card