TkA08G133280 | RubberDandelionOmics

Gene overview

TkA08G133280

Reference: TK1151 Chr: Chr08 Coordinates: 34629134-34632481 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1607 bp · TkA08G133280|TK1151|cDNA

ATGAAATATGCAAAGCTCTTCGTTGACTCAATCCTCTTTTAGAGCCTGAACTTGATTCTGTTTCTCGTACTCGTGTCATTTACATTTATTAATAGAGCTCTGCAATCTCTGTGTTTTTACTTCAATGGCGGCTCTTCGATTTCACCATCCACTTCTCACTTCCTCTTGTACTTCCTCTAATTCAACCCCTTTTCCGAAAACTCAGCTTCAGGGAAACCGTTTATTCAATCCACACGCTAACGGAAGTCTCAATTTGGTCT...

CDS

Download CDS FASTA

843 bp · TkA08G133280|TK1151|CDS

ATGGCGGCTCTTCGATTTCACCATCCACTTCTCACTTCCTCTTGTACTTCCTCTAATTCAACCCCTTTTCCGAAAACTCAGCTTCAGGGAAACCGTTTATTCAATCCACACGCTAACGGAAGTCTCAATTTGGTCTATGCTGCTCATCACAATGGAGACATACCCGGTTCGATTTCCAAGACGACATCTTTCGCCCAGTTGATTGAGTCGTTGATTGAGAGAAAGAACTTAACGGAGGCAGAGGCGGAGGAATCTCTTGA...

Protein

Download Protein FASTA

280 aa · TkA08G133280|TK1151|PROTEIN

MAALRFHHPLLTSSCTSSNSTPFPKTQLQGNRLFNPHANGSLNLVYAAHHNGDIPGSISKTTSFAQLIESLIERKNLTEAEAEESLDFLLRDANESRDKCFSCPLRSKGETYEEVVGLARAMFKHCKKVEGLEDAVDIVGTGGDGANTVNISTGSSILAAACGAKVAKQGNRSSSSACGSADVLEELGVAINLGPEGVKRCVEKAGIGFMMSPIYHPAMQIVRPVRKQLKVKTVFNILGPMLNPARVPFAVVGVYKEDLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G133280`
TK1151 ID	TkA08G133280
OH-1004 ID	LXL04_006119
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	72.100
Protein coverage (%)	TK1151 71.786 / OH-1004 42.138 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G133280

Location Chr08:34629134-34632481 (+)

Description Similar to PAT1: Anthranilate phosphoribosyltransferase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17990`	Anthranilate phosphoribosyltransferase, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006119 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000162 L-tryptophan biosynthetic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0004048 anthranilate phosphoribosyltransferase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G17990

cca:CCA_00563

cfe:CF0439

deh:cbdbA1444

msi:Msm_1144

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.974

Rank 1 · TkA08G133280 · TK1151

Mitochondrion0.044

Rank 2 · TkA08G133280 · TK1151

Cytoplasm0.022

Rank 3 · TkA08G133280 · TK1151

Nucleus0.015

Rank 4 · TkA08G133280 · TK1151

Peroxisome0.014

Rank 5 · TkA08G133280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02885Glycos_trans_3N66-126 aa

PF00591Glycos_transf_3133-266 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G133280	`PF02885`	Glycos_trans_3N	66	126	2.4e-07	31.1
TkA08G133280	`PF00591`	Glycos_transf_3	133	266	1.7e-58	199.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q02166`	Arabidopsis thaliana	sp\|Q02166\|TRPD_ARATH Anthranilate phosphoribosyltransferase, chloroplastic	74.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card