TkA08G124070 | RubberDandelionOmics

Gene overview

TkA08G124070

Reference: TK1151 Chr: Chr08 Coordinates: 32232333-32237674 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2841 bp · TkA08G124070|TK1151|cDNA

AGTTAACGAATAAGGAAATGACTACTACCGCCAAAACAGGCGATCAAAAATCAGAAGCTGTTTCAAGAGCTCACAACTTCGGCTCTACATGGGAACAGGTTCTGTTGTCATTTTTCATATCATTTACTGTTACTTGATCTTAAAAGTCTTGTAATTTTACAATTTTTGATTGGAATTGATACGTTGTGGGCGATGTCTACCAACACGAAACCTGAATATTAGCTGATGCATACATAGAAATCGACATTGTCAAATGGTAA...

CDS

Download CDS FASTA

1179 bp · TkA08G124070|TK1151|CDS

ATGATACGTACTCATGTTCTTTCTGTTCTCAAAAGCAGTACTTCTCAGGTCCAAACAGCACTCAAGGGTAGTGGTGGCAGCAAAACAGGTGTTTCTGAAGGTGTTGAGGCATCTATCATATATGTTAGGTTCAAAGCAGCAGCAAGTGAGCTTAAACCAGTACTCGAAGAAATCGAAAGGAGATCCTCAAGAAAAGAGTATGTTCAAATCCTTTCAGAATGTCACAGAATATACTGTGAACAACGCCTATCTTTGGTAAA...

Protein

Download Protein FASTA

392 aa · TkA08G124070|TK1151|PROTEIN

MIRTHVLSVLKSSTSQVQTALKGSGGSKTGVSEGVEASIIYVRFKAAASELKPVLEEIERRSSRKEYVQILSECHRIYCEQRLSLVKGIVSQRITKYSKKETLPSLTRSGCAYLMQVCQLEHQLFDHFFPSTSEDISSLAPLVDPLCTFLYDTLRPKLIHETNLDVLCELVDILKIEVIGEQLSRRSESLAGIRPTLDRILADIHERLTFRARTHIRDEIANYLPLDEDLDYPGKLEQSPDTKSDPTSIDLSSDVVKTWY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G124070`
TK1151 ID	TkA08G124070
OH-1004 ID	LXL04_018798
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.500
Protein coverage (%)	TK1151 100.000 / OH-1004 50.256 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G124070

Location Chr08:32232333-32237674 (-)

Description Similar to COG3: Conserved oligomeric Golgi complex subunit 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g73430`	Acts as a component of the peripheral membrane COG complex that is involved in intra-Golgi protein trafficking.	Arabidopsis COG Complex Subunits COG3 and COG8 Modulate Golgi Morphology, Vesicle Trafficking Homeostasis and Are Essential for Pollen Tube Growth.2016 · DOI: 10.1371/journal.pgen.1006140

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018798 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000301 retrograde transport, vesicle recycling within Golgi Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0006891 intra-Golgi vesicle-mediated transport Biological Process

GO:0007030 Golgi organization Biological Process

GO:0009101 glycoprotein biosynthetic process Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0033365 protein localization to organelle Biological Process

GO:0048193 Golgi vesicle transport Biological Process

GO:0050821 protein stabilization Biological Process

GO:0000139 Golgi membrane Cellular Component

KEGG gene cross-reference

aag:5570156

ath:AT1G73430

dpo:4817142

hsa:83548

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.533

Rank 1 · TkA08G124070 · TK1151

Cytoplasm0.503

Rank 2 · TkA08G124070 · TK1151

Cell membrane0.137

Rank 3 · TkA08G124070 · TK1151

Endoplasmic reticulum0.121

Rank 4 · TkA08G124070 · TK1151

Lysosome / Vacuole0.117

Rank 5 · TkA08G124070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20671COG3_C39-347 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G124070	`PF20671`	COG3_C	39	347	9.1e-106	354.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HQ84`	Arabidopsis thaliana	sp\|F4HQ84\|COG3_ARATH Conserved oligomeric Golgi complex subunit 3	79.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card