TkA08G102820 | RubberDandelionOmics

Gene overview

TkA08G102820

Reference: TK1151 Chr: Chr08 Coordinates: 26649992-26652396 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

933 bp · TkA08G102820|TK1151|cDNA

ATGGAGTTTGAGTCATCATGTGTTCCTCCAGGATTCAGATTTCACCCTACTGAGGAAGAACTCGTGGGTTACTATCTCAAAAGGAAAGTCGAGTCACTGCAAATCGATCTTGATGTTATTGTCGAAATTGATCTTTACAGAATGGAGCCTTGGGATATTGAAGGAAGGTGCAAATTGGGATACGAAGAACAAAACGAGTGGTTTTTCTTCAGTCACAAAGATAGAAAGTACCCTACTGGAACACGAACAAATAGAGCAAC...

CDS

Download CDS FASTA

933 bp · TkA08G102820|TK1151|CDS

ATGGAGTTTGAGTCATCATGTGTTCCTCCAGGATTCAGATTTCACCCTACTGAGGAAGAACTCGTGGGTTACTATCTCAAAAGGAAAGTCGAGTCACTGCAAATCGATCTTGATGTTATTGTCGAAATTGATCTTTACAGAATGGAGCCTTGGGATATTGAAGGAAGGTGCAAATTGGGATACGAAGAACAAAACGAGTGGTTTTTCTTCAGTCACAAAGATAGAAAGTACCCTACTGGAACACGAACAAATAGAGCAAC...

Protein

Download Protein FASTA

310 aa · TkA08G102820|TK1151|PROTEIN

MEFESSCVPPGFRFHPTEEELVGYYLKRKVESLQIDLDVIVEIDLYRMEPWDIEGRCKLGYEEQNEWFFFSHKDRKYPTGTRTNRATAAGFWKATGRDKAVLSKDRIIGMRKTLVFYNGRAPNGRKSDWIMHEYRLQSSQNAPPQEEGWVVCRAFKKPCPVQKQGYEAWNNGYYIRNTNNIRSLPPINDTFNSSQSNQATVSHKLLPFNDPDYDQQLSVNHFLLENSNIDSPSASRSFATNEDHDYESTGIDFNHYDNDW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G102820`
TK1151 ID	TkA08G102820
OH-1004 ID	LXL04_013813
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	65.500
Protein coverage (%)	TK1151 63.548 / OH-1004 51.047 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G102820

Location Chr08:26649992-26652396 (+)

Description Similar to NAC076: NAC domain-containing protein 76

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g71930`	May bind promoters of secondary cell-wall genes and activate transcription.	Transcription switches for protoxylem and metaxylem vessel formation.2005 · DOI: 10.1101/gad.1331305 Vascular-related NAC-DOMAIN7 is involved in the differentiation of all types of xylem vessels in Arabidopsis roots and shoots.2008 · DOI: 10.1111/j.1365-313x.2008.03533.x A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis.2008 · DOI: 10.1105/tpc.108.061325 ASYMMETRIC LEAVES2-LIKE19/LATERAL ORGAN BOUNDARIES DOMAIN30 and ASL20/LBD18 regulate tracheary element differentiation in Arabidopsis.2008 · DOI: 10.1105/tpc.108.061796 MYB58 and MYB63 are transcriptional activators of the lignin biosynthetic pathway during secondary cell wall formation in Arabidopsis.2009 · DOI: 10.1105/tpc.108.063321 MYB83 is a direct target of SND1 and acts redundantly with MYB46 in the regulation of secondary cell wall biosynthesis in Arabidopsis.2009 · DOI: 10.1093/pcp/pcp139 VASCULAR-RELATED NAC-DOMAIN6 and VASCULAR-RELATED NAC-DOMAIN7 effectively induce transdifferentiation into xylem vessel elements under control of an induction system.2010 · DOI: 10.1104/pp.110.154013 Global analysis of direct targets of secondary wall NAC master switches in Arabidopsis.2010 · DOI: 10.1093/mp/ssq062 VASCULAR-RELATED NAC-DOMAIN7 directly regulates the expression of a broad range of genes for xylem vessel formation.2011 · DOI: 10.1111/j.1365-313x.2011.04514.x The Arabidopsis thaliana checkpoint kinase WEE1 protects against premature vascular differentiation during replication stress.2011 · DOI: 10.1105/tpc.110.082768 Verticillium infection triggers VASCULAR-RELATED NAC DOMAIN7-dependent de novo xylem formation and enhances drought tolerance in Arabidopsis.2012 · DOI: 10.1105/tpc.112.103374
`At2g18060`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726
`At4g36160`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	No verified direct reference in this release
`At5g66300`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726
`At1g12260`	Transcription activator that binds to the secondary wall NAC binding element (SNBE), 5'-(T/A)NN(C/T)(T/C/G)TNNNNNNNA(A/C)GN(A/C/T)(A/T)-3', in the promoter of target genes (By similarity).	Arabidopsis NAC domain proteins, VND1 to VND5, are transcriptional regulators of secondary wall biosynthesis in vessels.2014 · DOI: 10.1371/journal.pone.0105726

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013813 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0048759 xylem vessel member cell differentiation Biological Process

GO:0071555 cell wall organization Biological Process

GO:1901348 positive regulation of secondary cell wall biogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G12260

ath:AT1G62700

ath:AT2G18060

ath:AT4G36160

ath:AT5G66300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.936

Rank 1 · TkA08G102820 · TK1151

Cytoplasm0.127

Rank 2 · TkA08G102820 · TK1151

Cell membrane0.046

Rank 3 · TkA08G102820 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkA08G102820 · TK1151

Plastid0.017

Rank 5 · TkA08G102820 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365NAM9-136 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G102820	`PF02365`	NAM	9	136	3.3e-46	157.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C8W9`	Arabidopsis thaliana	sp\|Q9C8W9\|NAC30_ARATH NAC domain-containing protein 30	53.300%	Swiss-Prot	High
`Q9SL41`	Arabidopsis thaliana	sp\|Q9SL41\|NAC37_ARATH NAC domain-containing protein 37	67.300%	Swiss-Prot	Medium
`O65508`	Arabidopsis thaliana	sp\|O65508\|NAC76_ARATH NAC domain-containing protein 76	73.300%	Swiss-Prot	Medium
`Q9FH59`	Arabidopsis thaliana	sp\|Q9FH59\|NC105_ARATH NAC domain-containing protein 105	69.800%	Swiss-Prot	Medium
`Q9FWX2`	Arabidopsis thaliana	sp\|Q9FWX2\|NAC7_ARATH NAC domain-containing protein 7	72.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card