TkA08G089800 | RubberDandelionOmics

Gene overview

TkA08G089800

Reference: TK1151 Chr: Chr08 Coordinates: 23259950-23262012 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1298 bp · TkA08G089800|TK1151|cDNA

ATGAATTTATGCAAAAATTGATCTAGAAGCTGTAGGCTATCCTTTTGAATCGCGGGATTTCAATATCAACTACGTAAACGAAGATTCCCAGACATTCAAGGATGGATCTTCCGCAAGATATTGATGATTACTTACGGGAATCGATAGAATATACACTCTGCCTTCCAGTATCTACACGTACGCTGGAGTTAAAGCTTCGATCGTCTGAAGAAGCACAAAGGCATATTCGCGATCAGTGCTTCTATTTGAAATCGAAATTG...

CDS

Download CDS FASTA

981 bp · TkA08G089800|TK1151|CDS

ATGGATCTTCCGCAAGATATTGATGATTACTTACGGGAATCGATAGAATATACACTCTGCCTTCCAGTATCTACACGTACGCTGGAGTTAAAGCTTCGATCGTCTGAAGAAGCACAAAGGCATATTCGCGATCAGTGCTTCTATTTGAAATCGAAATTGCTGGAGAAAGATAAAGCCATCGATGGTGCTAGGGCTGAATCAAGCATGAATGCACAAGCTGTAAAGAAGTTTATAGAAGAGAATCAGAAATTAGCTATGGA...

Protein

Download Protein FASTA

326 aa · TkA08G089800|TK1151|PROTEIN

MDLPQDIDDYLRESIEYTLCLPVSTRTLELKLRSSEEAQRHIRDQCFYLKSKLLEKDKAIDGARAESSMNAQAVKKFIEENQKLAMECGNLVARCTKLEKECSLYDHDVEVLMEFGNEADERAKEAELRAHCLEEKLSKLSEELEAFKHQSQAQNGGEVTDSESSEEDLLVVTLLSTLINNDEVASTAHSFLEANSGVDVCQKILKTWDSLKPSTRVVLALACEVKKLQKDKDNLRINLTKAEEEVIVLCNENDILDKEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G089800`
TK1151 ID	TkA08G089800
OH-1004 ID	LXL04_031145
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G089800`
Location	Chr08:23259950-23262012 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031145` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.542

Rank 1 · TkA08G089800 · TK1151

Cytoplasm0.434

Rank 2 · TkA08G089800 · TK1151

Cell membrane0.062

Rank 3 · TkA08G089800 · TK1151

Golgi apparatus0.032

Rank 4 · TkA08G089800 · TK1151

Endoplasmic reticulum0.032

Rank 5 · TkA08G089800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03431RNA_replicase_B9-90 aa

PF17097Kre2824-144 aa

PF19220Rod_CreS26-101 aa

PF00261Tropomyosin27-153 aa

PF29997SPC25_N28-65 aa

PF13851GAS32-88 aa

PF25464DUF790036-122 aa

PF16526CLZ53-102 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G089800	`PF03431`	RNA_replicase_B	9	90	0.068	12.4
TkA08G089800	`PF17097`	Kre28	24	144	3.2	7.4
TkA08G089800	`PF19220`	Rod_CreS	26	101	2.8	7.7
TkA08G089800	`PF00261`	Tropomyosin	27	153	0.073	13.2
TkA08G089800	`PF29997`	SPC25_N	28	65	0.0031	18.5
TkA08G089800	`PF13851`	GAS	32	88	0.28	11.3
TkA08G089800	`PF25464`	DUF7900	36	122	1.3	10.4
TkA08G089800	`PF16526`	CLZ	53	102	8.9	7.5
TkA08G089800	`PF12325`	TMF_TATA_bd	65	150	0.7	10.8
TkA08G089800	`PF11365`	SOGA	66	101	2.8	9.8
TkA08G089800	`PF29997`	SPC25_N	69	147	0.0031	18.5
TkA08G089800	`PF06156`	YabA	69	101	0.038	15.3
TkA08G089800	`PF13851`	GAS	69	150	0.28	11.3
TkA08G089800	`PF30820`	SPZ1-like	70	119	3.9	8.2
TkA08G089800	`PF28175`	T4SS_LegC2C7	71	152	0.024	14.2
TkA08G089800	`PF26095`	CC_Bre1	72	138	0.2	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card