RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G089200
Reference: TK1151 Chr: Chr08 Coordinates: 23102073-23104027 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1433 bp · TkA08G089200|TK1151|cDNA

TAGCTGCTTTGCATGGTACCATAGTTCTTTGTGTCCCCATATAATAAATTATTATTTTAAGTTTCCCCAAAAGTAATTTCAAAAAATTTGCTTACGAAGGAAGGAAAACATTACCATCATCACCACCGTACCCATGGAGGCGAAAGTTAGTCCGGCAGCAAAGAAGACGCTTTTAATCTTGAATAGTGTCTTGTTATTCATCGGATTCAGCGGTGGTCCATTGATCATGCGGCTCTACTACATCCACGGTGGCAACCGTC...

CDS

Download CDS FASTA

1092 bp · TkA08G089200|TK1151|CDS

ATGGAGGCGAAAGTTAGTCCGGCAGCAAAGAAGACGCTTTTAATCTTGAATAGTGTCTTGTTATTCATCGGATTCAGCGGTGGTCCATTGATCATGCGGCTCTACTACATCCACGGTGGCAACCGTCTCTGGTTGTCATCGTTCCTTGAGACAGCCGGGTGGCCGGTCATCGTTGTGGTCCTCATAATTCTCTACTTTTACCGCCGTGCCACCGGAAAAAACGAAAACAATAAAAGAACAAAGGTAATCTACATGCGCCC...

Protein

Download Protein FASTA

363 aa · TkA08G089200|TK1151|PROTEIN

MEAKVSPAAKKTLLILNSVLLFIGFSGGPLIMRLYYIHGGNRLWLSSFLETAGWPVIVVVLIILYFYRRATGKNENNKRTKVIYMRPRLFLAVAFIGVLTGVDDYLYAYGLSRLPVSTSALIIASQLGFTALFAFLLVKQKFTAYSINAVVLLTAGAAVLALHTNSDRPEGESKRDYLMGFVLTVASAVLYGFVLPLMELTYNKAKQEITYTLVLEIQAVMCLFVTIFCTVGMIINNDYKVIPREATEFELGKSEYYIIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G089200
TK1151 IDTkA08G089200
OH-1004 IDLXL04_031136
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)76.500
Protein coverage (%)TK1151 97.245 / OH-1004 94.385
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G089200
LocationChr08:23102073-23104027 (+)
DescriptionSimilar to PUP3: Purine permease 3
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g28230 Proton-coupled purine transporter mediating adenine and trans-zeatin uptake.
Transport of cytokinins mediated by purine transporters of the PUP family expressed in phloem, hydathodes, and pollen of Arabidopsis.2003 · DOI: 10.1046/j.1365-313x.2003.01700.x
Recycling of pyridoxine (vitamin B6) by PUP1 in Arabidopsis.2013 · DOI: 10.1111/tpj.12195
At1g28220 May be involved in transport of purine derivatives during pollen germination and tube elongation.
Transport of cytokinins mediated by purine transporters of the PUP family expressed in phloem, hydathodes, and pollen of Arabidopsis.2003 · DOI: 10.1046/j.1365-313x.2003.01700.x
At2g33750 Mediates adenine transport.
Transport of cytokinins mediated by purine transporters of the PUP family expressed in phloem, hydathodes, and pollen of Arabidopsis.2003 · DOI: 10.1046/j.1365-313x.2003.01700.x
At1g44750 Probable purine permease 11. No verified direct reference in this release
At1g30840 Probable purine permease 4. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_031136 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006863 purine nucleobase transport Biological Process
GO:0009624 response to nematode Biological Process
GO:0010184 cytokinin transport Biological Process
GO:0005737 cytoplasm Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0016020 membrane Cellular Component
GO:0005345 purine nucleobase transmembrane transporter activity Molecular Function
GO:0015211 purine nucleoside transmembrane transporter activity Molecular Function
GO:0022857 transmembrane transporter activity Molecular Function
KEGG gene cross-reference
ath:AT1G28220
ath:AT1G28230
ath:AT2G33750
ath:AT4G18210
ath:AT4G18220
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.460
Rank 1 · TkA08G089200 · TK1151
Lysosome / Vacuole0.223
Rank 2 · TkA08G089200 · TK1151
Endoplasmic reticulum0.170
Rank 3 · TkA08G089200 · TK1151
Golgi apparatus0.101
Rank 4 · TkA08G089200 · TK1151
Cytoplasm0.094
Rank 5 · TkA08G089200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16913PUNUT13-337 aa
PF00892EamA47-160 aa
PF04087DUF38948-86 aa
PF05961Chordopox_A13L56-81 aa
PF04142Nuc_sug_transp57-270 aa
PF13687DUF415357-163 aa
PF04087DUF38999-136 aa
PF13687DUF4153151-231 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA08G089200PF16913PUNUT133377.1e-112374.5
TkA08G089200PF00892EamA471607e-0936.8
TkA08G089200PF04087DUF38948867.47.3
TkA08G089200PF05961Chordopox_A13L56810.4311.6
TkA08G089200PF04142Nuc_sug_transp572702.8e-0524.1
TkA08G089200PF13687DUF4153571630.002617.7
TkA08G089200PF04087DUF389991367.47.3
TkA08G089200PF13687DUF41531512310.002617.7
TkA08G089200PF04087DUF3891602227.47.3
TkA08G089200PF00892EamA1793257e-0936.8
TkA08G089200PF04087DUF3892683007.47.3
TkA08G089200PF13687DUF41532773240.002617.7
TkA08G089200PF05961Chordopox_A13L2883060.4311.6
TkA08G089200PF04142Nuc_sug_transp2933402.8e-0524.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FZ96Arabidopsis thalianasp|Q9FZ96|PUP1_ARATH Purine permease 157.700%Swiss-ProtHigh
Q9FZ95Arabidopsis thalianasp|Q9FZ95|PUP3_ARATH Purine permease 353.000%Swiss-ProtHigh
Q94GB1Arabidopsis thalianasp|Q94GB1|PUP2_ARATH Purine permease 250.100%Swiss-ProtHigh
Q9LPF6Arabidopsis thalianasp|Q9LPF6|PUP11_ARATH Probable purine permease 1132.600%Swiss-ProtMedium
Q9SY29Arabidopsis thalianasp|Q9SY29|PUP4_ARATH Probable purine permease 431.800%Swiss-ProtMedium

JBrowse

View in Genome Browser