TkA08G082920 | RubberDandelionOmics

Gene overview

TkA08G082920

Reference: TK1151 Chr: Chr08 Coordinates: 21330697-21335481 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1225 bp · TkA08G082920|TK1151|cDNA

TACAACATCATTCTATTTTATTCGTTAAAAACTAAAAAACACAGTGAGTTCCTTTCCAATTTAATTTCATTTTTATTTCTTTGCGTTAAAAAGCTAAAAAACACAAGTGGTTTTACGAACGCTAAACCCCCTTTTCAATCTACTGCAACTCCTAATCAAACAATGGAAGAAAACGCTGTTCGAATCATCATACAAGACGCAACTCCGTCAGCCGAAGAATTTACTTCGCAGCTTGAACCCAAAAACGTCCCTACTGTCTT...

CDS

Download CDS FASTA

1611 bp · TkA08G082920|TK1151|CDS

TACAACATCATTCTATTTTATTCGTTAAAAACTAAAAAACACAGTGAGTTCCTTTCCAATTTAATTTCATTTTTATTTCTTTGCGTTAAAAAGCTAAAAAACACAAGTGGTTTTACGAACGCTAAACCCCCTTTTCAATCTACTGCAACTCCTAATCAAACAATGGAAGAAAACGCTGTTCGAATCATCATACAAGACGCAACTCCGTCAGCCGAAGAATTTACTTCGCAGCTTGAACCCAAAAACGTCCCTACTGTCTT...

Protein

Download Protein FASTA

536 aa · TkA08G082920|TK1151|PROTEIN

YNIILFYSLKTKKHSEFLSNLISFLFLCVKKLKNTSGFTNAKPPFQSTATPNQTMEENAVRIIIQDATPSAEEFTSQLEPKNVPTVFHGCVNDWKAFSKWNPSIGGLDYLQGLAGSSSVEVMLSKSAPVFYGDIRNHERVQLPLSTFIEYCKNVSNPDSLETEQDQIYLAQVPIMNTDKEEKVQLGSLINDIQTPLFLETKNLASINLWINGYKTRSSTHYDPHHNLLCVVSGTKQVDLWPPSSTPLLYPMPLYGEASNH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G082920`
TK1151 ID	TkA08G082920
OH-1004 ID	LXL04_018785
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 89.925 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G082920

Location Chr08:21330697-21335481 (+)

Description Similar to TYW5: tRNA wybutosine-synthesizing protein 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g19840`	May function as histone H3 lysine demethylase and be involved in regulation of gene expression.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018785 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000086 G2/M transition of mitotic cell cycle Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0010378 temperature compensation of the circadian clock Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0031591 wybutosine biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT3G20810

ath:AT5G19840

dme:Dmel_CG13902

mmu:68736

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.529

Rank 1 · TkA08G082920 · TK1151

Nucleus0.397

Rank 2 · TkA08G082920 · TK1151

Mitochondrion0.096

Rank 3 · TkA08G082920 · TK1151

Cell membrane0.072

Rank 4 · TkA08G082920 · TK1151

Golgi apparatus0.067

Rank 5 · TkA08G082920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13621Cupin_872-320 aa

PF07883Cupin_2216-236 aa

PF08007JmjC_2281-314 aa

PF02373JmjC283-315 aa

PF07883Cupin_2284-308 aa

PF02373JmjC432-457 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G082920	`PF13621`	Cupin_8	72	320	2.3e-52	179.1
TkA08G082920	`PF07883`	Cupin_2	216	236	0.17	12.3
TkA08G082920	`PF08007`	JmjC_2	281	314	0.0003	21.1
TkA08G082920	`PF02373`	JmjC	283	315	0.00095	20.3
TkA08G082920	`PF07883`	Cupin_2	284	308	0.17	12.3
TkA08G082920	`PF02373`	JmjC	432	457	0.00095	20.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K2M8`	Arabidopsis thaliana	sp\|F4K2M8\|JMJ31_ARATH Lysine-specific demethylase JMJ31	49.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card