TkA08G080080 | RubberDandelionOmics

Gene overview

TkA08G080080

Reference: TK1151 Chr: Chr08 Coordinates: 20552739-20556473 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2285 bp · TkA08G080080|TK1151|cDNA

ACATCCATTTGGGAGGACGAGTGCTCTAACCATCTGTACAAGCAATCACCGGTACCCGCTACTTTTTCCCAAAATCGGTGCTTAGAAGACTATTCTTGCGAACAACGCTGTCTTACTTTGATTCTTTGAAACCGTTTGCTTCCGCGGGCTCTTCTTTTCCAACGAACCCTAGAAACGCAGGAACGAAAATCAAATTCAATCCAGTTGATCTTCAACTTTATTTGCGATGGCGATGGCAAGCATATACAGAAGAGTTCTCC...

CDS

Download CDS FASTA

1464 bp · TkA08G080080|TK1151|CDS

ATGGCGATGGCAAGCATATACAGAAGAGTTCTCCCATCTCCTCCTGCTATCGATTTCGCTTCTTCCGAAGGAAAGCAATTGTTCATGGAAGCTACGCAAGGCGGAACCATGGAAGGCTTCTTCAAGCTGATCTCTTACTTCCAGACACAATCAGAACCTGCCTACTGTGGATTAGCTACCCTCGCCATGGTCCTGAATGCACTTTCTATCGATCCTGGTAGAAAATGGAAAGGTCCATGGAGGTGGTTTGATGAATCTAT...

Protein

Download Protein FASTA

487 aa · TkA08G080080|TK1151|PROTEIN

MAMASIYRRVLPSPPAIDFASSEGKQLFMEATQGGTMEGFFKLISYFQTQSEPAYCGLATLAMVLNALSIDPGRKWKGPWRWFDESMLDCCEPLEKVKAKGISFGKVVCLAHCAGAKVEAFRTNQSNIDDFRKHVIACSTSDDCHVISSYNRATFKQTGSGHFSPIGGYHAGKDMALILDVARFKYPPHWVPLKLLWEAMDTLDDASGFRRGFMLISRLQRPPALLYTLSCKHDSWVNIAKYLVEDVPVLLTATNVKNIN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G080080`
TK1151 ID	TkA08G080080
OH-1004 ID	LXL04_000913
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	70.600
Protein coverage (%)	TK1151 99.589 / OH-1004 99.575 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G080080

Location Chr08:20552739-20556473 (-)

Description Similar to PCS1: Glutathione gamma-glutamylcysteinyltransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44070`	Involved in the synthesis of phytochelatins (PC) and homophytochelatins (hPC), the heavy-metal-binding peptides of plants.	No verified direct reference in this release
`At1g03980`	Involved in the synthesis of phytochelatins (PC) and homophytochelatins (hPC), the heavy-metal-binding peptides of plants.	Arabidopsis thaliana expresses a second functional phytochelatin synthase.2001 · DOI: 10.1016/s0014-5793(01)02976-3 Expression of Arabidopsis phytochelatin synthase 2 is too low to complement an AtPCS1-defective Cad1-3 mutant.2005 · DOI: 10.1016/s1016-8478(23)13140-2 Function of phytochelatin synthase in catabolism of glutathione-conjugates.2007 · DOI: 10.1111/j.1365-313x.2006.02993.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000913 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006950 response to stress Biological Process

GO:0010273 detoxification of copper ion Biological Process

GO:0015700 arsenite transport Biological Process

GO:0042344 indole glucosinolate catabolic process Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0046685 response to arsenic-containing substance Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0046938 phytochelatin biosynthetic process Biological Process

GO:0052544 defense response by callose deposition in cell wall Biological Process

GO:0098849 cellular detoxification of cadmium ion Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT1G03980

ath:AT5G44070

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.507

Rank 1 · TkA08G080080 · TK1151

Nucleus0.351

Rank 2 · TkA08G080080 · TK1151

Cell membrane0.125

Rank 3 · TkA08G080080 · TK1151

Mitochondrion0.095

Rank 4 · TkA08G080080 · TK1151

Golgi apparatus0.088

Rank 5 · TkA08G080080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05023Phytochelatin7-213 aa

PF13529Peptidase_C39_247-72 aa

PF03412Peptidase_C3948-68 aa

PF09328Phytochelatin_C85-143 aa

PF03412Peptidase_C3995-145 aa

PF13529Peptidase_C39_2148-182 aa

PF09328Phytochelatin_C231-411 aa

PF13529Peptidase_C39_2234-253 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G080080	`PF05023`	Phytochelatin	7	213	1.1e-90	303.2
TkA08G080080	`PF13529`	Peptidase_C39_2	47	72	0.039	15.0
TkA08G080080	`PF03412`	Peptidase_C39	48	68	0.018	15.6
TkA08G080080	`PF09328`	Phytochelatin_C	85	143	1.3e-96	323.7
TkA08G080080	`PF03412`	Peptidase_C39	95	145	0.018	15.6
TkA08G080080	`PF13529`	Peptidase_C39_2	148	182	0.039	15.0
TkA08G080080	`PF09328`	Phytochelatin_C	231	411	1.3e-96	323.7
TkA08G080080	`PF13529`	Peptidase_C39_2	234	253	0.039	15.0
TkA08G080080	`PF09328`	Phytochelatin_C	410	467	1.3e-96	323.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9S7Z3`	Arabidopsis thaliana	sp\|Q9S7Z3\|PCS1_ARATH Glutathione gamma-glutamylcysteinyltransferase 1	63.300%	Swiss-Prot	High
`Q9ZWB7`	Arabidopsis thaliana	sp\|Q9ZWB7\|PCS2_ARATH Glutathione gamma-glutamylcysteinyltransferase 2	62.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card