TkA08G075990 | RubberDandelionOmics

Gene overview

TkA08G075990

Reference: TK1151 Chr: Chr08 Coordinates: 19510500-19513321 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1537 bp · TkA08G075990|TK1151|cDNA

GATGTAAAAATAAACAATAATAATCCCCACTCTTCTCGTTCCTCGCCTTCGAGACTATTATATAAAACCCTGGAAACCCTTTTGACGCAAAATACTCGTTCCTCGTTGCTCTGTACGCACCAGCGAGATCCGTAAGCGCAACTACAAACCCTAACCCAATCGAAGAAGTAGAGAGAGAAAGAAAGAACAGGATCACAGATTCTCTCTTTCTCTCTCACTTCAACCTCGATCTCGACACATCTTGATCCTTGATTTTGGGG...

CDS

Download CDS FASTA

1245 bp · TkA08G075990|TK1151|CDS

ATGGCGGCTCCGGCAGATGTTGCGGCGCCTGTATCTGCTCAAGTTGTTGGAAATGCTTTTGTTCAGCAGTATTATCACATACTGCACCAGTCACCTGGTCTAGTTCACAAGTTCTACCATGAAGACAGTAAACTTGGTCGCCCTGAGGAAGATGGCACTCTCAGCCTAACCACCACCATGGATGAAATCAATGCCAAAATCCTCTCCCTCAACTACGAAGACTTCAAAGCCGAGATCAAAACCGTTGATGCACAAGAATC...

Protein

Download Protein FASTA

414 aa · TkA08G075990|TK1151|PROTEIN

MAAPADVAAPVSAQVVGNAFVQQYYHILHQSPGLVHKFYHEDSKLGRPEEDGTLSLTTTMDEINAKILSLNYEDFKAEIKTVDAQESSEGGVNVLVTGHLTGKDNFVHDFTQSFFLAPQDKGYFVLNDMFRYMDKPKHTESTPTEDVVLDPVPTLEQEVPPVSEVDNNTPDQSADVAKEPQPEKIEENGEVQVPVVDVEEEEEVEEEEPVAEVVDEVPDSSSKVVAVEVVEVVNTKTEEPIKKSYASIVMDLKQNGGPFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G075990`
TK1151 ID	TkA08G075990
OH-1004 ID	LXL04_018656
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 92.754 / OH-1004 78.528 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G075990

Location Chr08:19510500-19513321 (+)

Description Similar to NTF2: Nuclear transport factor 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60980`	Involved in RNA-directed DNA methylation (RdDM).	AtMBD6, a methyl CpG binding domain protein, maintains gene silencing in Arabidopsis by interacting with RNA binding proteins.2017 · DOI: 10.1007/s12038-016-9658-1

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018656 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0032481 positive regulation of type I interferon production Biological Process

GO:0034063 stress granule assembly Biological Process

GO:0045087 innate immune response Biological Process

GO:0051028 mRNA transport Biological Process

GO:0051260 protein homooligomerization Biological Process

GO:0051607 defense response to virus Biological Process

GO:0090090 negative regulation of canonical Wnt signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT5G60980

hsa:9908

mmu:27041

pon:100172655

spo:2541364

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.652

Rank 1 · TkA08G075990 · TK1151

Nucleus0.243

Rank 2 · TkA08G075990 · TK1151

Golgi apparatus0.125

Rank 3 · TkA08G075990 · TK1151

Cell membrane0.120

Rank 4 · TkA08G075990 · TK1151

Endoplasmic reticulum0.096

Rank 5 · TkA08G075990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02136NTF216-132 aa

PF22602NXF_NTF218-44 aa

PF22602NXF_NTF281-130 aa

PF00076RRM_1312-371 aa

PF16367RRM_7312-372 aa

PF30866NUP53_M343-385 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G075990	`PF02136`	NTF2	16	132	1.5e-32	113.2
TkA08G075990	`PF22602`	NXF_NTF2	18	44	0.049	14.5
TkA08G075990	`PF22602`	NXF_NTF2	81	130	0.049	14.5
TkA08G075990	`PF00076`	RRM_1	312	371	4.6e-12	46.3
TkA08G075990	`PF16367`	RRM_7	312	372	0.1	13.3
TkA08G075990	`PF30866`	NUP53_M	343	385	0.15	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FME2`	Arabidopsis thaliana	sp\|Q9FME2\|NTF2_ARATH Nuclear transport factor 2	46.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card