TkA08G075280 | RubberDandelionOmics

Gene overview

TkA08G075280

Reference: TK1151 Chr: Chr08 Coordinates: 19344359-19345706 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

851 bp · TkA08G075280|TK1151|cDNA

AGCAAAGTGGCAAACCCTCCTTTCCGTTCGAATGTATATCTAAACCCTAGAGCTGCTCCATTATATCTCGCGGCTCTTCAAAGCAGCCAGATTTCTAACGCCGCCTTGTGATCTACCCATTAGCAGGTTCGGTTCGACACTCTACCTCTTGATTTTCCTTCTGTTCAGTCTGTTATTTAGATCTTCTACGCTCAGCCTCTTTGATTCAACGGTAAGCAATGGCAGTTCCTAAGCTTGATAAGAAAATCGTGAAGAAGCGT...

CDS

Download CDS FASTA

402 bp · TkA08G075280|TK1151|CDS

ATGGCAGTTCCTAAGCTTGATAAGAAAATCGTGAAGAAGCGTGTGAAGAAGTTCAAGAGGCCACACAGTGACTGGAAGATATGCGTCAAGGAAAACTGGAGAAGACCAAAGGGTATTGACTCTCGAGTCAGGAGGAAGTTCAAAGGTGTGACTCTTATGCCCAACATCGGGTACGGATCAGACAAGAAAACCCGACACTACCTCCCAAATGGATTCAAGAAATTCGTTGTTCACAACGCCAAAGAGTTGGAAGTTCTCAT...

Protein

Download Protein FASTA

133 aa · TkA08G075280|TK1151|PROTEIN

MAVPKLDKKIVKKRVKKFKRPHSDWKICVKENWRRPKGIDSRVRRKFKGVTLMPNIGYGSDKKTRHYLPNGFKKFVVHNAKELEVLMMHNRTYCAEIAHNVSTRKRKEIVERAAQLDVVVTNKLARLRSQEDE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G075280`
TK1151 ID	TkA08G075280
OH-1004 ID	LXL04_018643
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G075280

Location Chr08:19344359-19345706 (+)

Description Similar to RPL32A: 60S ribosomal protein L32-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18100`	Large ribosomal subunit protein eL32z.	No verified direct reference in this release
`At5g46430`	Large ribosomal subunit protein eL32y.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018643 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002181 cytoplasmic translation Biological Process

GO:0006412 translation Biological Process

GO:0006941 striated muscle contraction Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0071549 cellular response to dexamethasone stimulus Biological Process

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005840 ribosome Cellular Component

GO:0009536 plastid Cellular Component

GO:0015934 large ribosomal subunit Cellular Component

GO:0022625 cytosolic large ribosomal subunit Cellular Component

KEGG gene cross-reference

ath:AT4G18100

ath:AT5G46430

mmu:19951

rno:28298

ssc:414419

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.868

Rank 1 · TkA08G075280 · TK1151

Nucleus0.194

Rank 2 · TkA08G075280 · TK1151

Endoplasmic reticulum0.062

Rank 3 · TkA08G075280 · TK1151

Mitochondrion0.018

Rank 4 · TkA08G075280 · TK1151

Cell membrane0.010

Rank 5 · TkA08G075280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01655Ribosomal_L32e16-122 aa

PF00308Bac_DnaA65-130 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G075280	`PF01655`	Ribosomal_L32e	16	122	7e-49	165.3
TkA08G075280	`PF00308`	Bac_DnaA	65	130	0.14	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P49211`	Arabidopsis thaliana	sp\|P49211\|RL321_ARATH Large ribosomal subunit protein eL32z	85.700%	Swiss-Prot	High
`Q9FHG2`	Arabidopsis thaliana	sp\|Q9FHG2\|RL322_ARATH Large ribosomal subunit protein eL32y	83.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card