Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2078 bp · TkA08G072050|TK1151|cDNA
TATCCATGGGCCAATCGCCGCCGATGAGCTCAAACTCTCTTCCGGTCTACTCCACTCTTCACTTCCAGCTCTCTAATGGCGCCCCCGAGGATTTTACTGTGCGGAGATCCCCTTGGCAACCTGAATCAGCTATTCAAACGCGTTTCATCGGTTAATAAATCAACTGGTCCGTTTGATGCCTTATTGTGCGTCGGCCAATTCTTCCCTGACGCATCCGAGCGTTTGGAGGAGCTGACGGAGTACATAGAAGGCCGGAAGAA...
1782 bp · TkA08G072050|TK1151|CDS
ATGGCGCCCCCGAGGATTTTACTGTGCGGAGATCCCCTTGGCAACCTGAATCAGCTATTCAAACGCGTTTCATCGGTTAATAAATCAACTGGTCCGTTTGATGCCTTATTGTGCGTCGGCCAATTCTTCCCTGACGCATCCGAGCGTTTGGAGGAGCTGACGGAGTACATAGAAGGCCGGAAGAATATCCCGTTACCGACGTACTTCATCGGCGATTATGGAGCTGGCGCCGCCAAGGTTTTATCAGCCGCTGCGAAGGA...
Protein
Download Protein FASTA593 aa · TkA08G072050|TK1151|PROTEIN
MAPPRILLCGDPLGNLNQLFKRVSSVNKSTGPFDALLCVGQFFPDASERLEELTEYIEGRKNIPLPTYFIGDYGAGAAKVLSAAAKESSNQGFKMDGLKIRDNLFWLKGSGKFTLHGLSVAYLSGRQSPSSVIYGTYTQDDIDALRALAEEPGIIDIFLTNEWPNGIFNRASTSDIPPEISDSTGCDSTISEIVSEIKPRYHVAGSKGVYYAREPYINDNAVHVTRFIGLAPVGNPSKQKFIHAISPTPSSTMSTTDIST...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G072050 |
|---|---|
| TK1151 ID | TkA08G072050 |
| OH-1004 ID | LXL04_018606 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 90.500 |
| Protein coverage (%) | TK1151 95.784 / OH-1004 75.588Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G072050 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:18561818-18564670 (+) | ||||||||||||
| Description | Similar to At5g56900: Zinc finger CCCH domain-containing protein 64 | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0005634 nucleus Cellular Component GO:0071014 post-mRNA release spliceosomal complex Cellular Component GO:0003677 DNA binding Molecular Function GO:0008270 zinc ion binding Molecular Function GO:0061632 RNA lariat debranching enzyme activator activity Molecular Function | ||||||||||||
| KEGG gene cross-reference | ath:AT5G56900 dosa:Os09g0364000 mmu:72502 pon:100173021 xla:379111 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF25584zf-CCCH_RBM22105-110 aaPF16131Torus287-334 aaPF25585zf-CCCH_DUS3L305-331 aaPF18044zf-CCCH_4307-328 aaPF25261zf-CCCH_PARP12307-331 aaPF18345zf_CCCH_4308-327 aaPF15663zf-CCCH_3308-364 aaPF22623zf-CCCH_9308-328 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G072050 | PF25584 | zf-CCCH_RBM22 | 105 | 110 | 0.019 | 15.7 |
| TkA08G072050 | PF16131 | Torus | 287 | 334 | 8.5e-07 | 30.2 |
| TkA08G072050 | PF25585 | zf-CCCH_DUS3L | 305 | 331 | 4.6e-09 | 36.8 |
| TkA08G072050 | PF18044 | zf-CCCH_4 | 307 | 328 | 0.00063 | 20.2 |
| TkA08G072050 | PF25261 | zf-CCCH_PARP12 | 307 | 331 | 0.02 | 15.8 |
| TkA08G072050 | PF18345 | zf_CCCH_4 | 308 | 327 | 2.9e-06 | 27.9 |
| TkA08G072050 | PF15663 | zf-CCCH_3 | 308 | 364 | 0.0047 | 17.8 |
| TkA08G072050 | PF22623 | zf-CCCH_9 | 308 | 328 | 0.03 | 14.8 |
| TkA08G072050 | PF22628 | zf-CCCH_10 | 308 | 327 | 2.4 | 8.4 |
| TkA08G072050 | PF25584 | zf-CCCH_RBM22 | 313 | 327 | 0.019 | 15.7 |
| TkA08G072050 | PF23261 | zf-CCCH_11 | 313 | 327 | 0.075 | 13.3 |
| TkA08G072050 | PF00642 | zf-CCCH | 314 | 328 | 0.0041 | 17.7 |
| TkA08G072050 | PF16131 | Torus | 331 | 369 | 8.5e-07 | 30.2 |
| TkA08G072050 | PF22628 | zf-CCCH_10 | 339 | 359 | 2.4 | 8.4 |
| TkA08G072050 | PF25585 | zf-CCCH_DUS3L | 340 | 362 | 4.6e-09 | 36.8 |
| TkA08G072050 | PF18345 | zf_CCCH_4 | 340 | 359 | 2.9e-06 | 27.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.