TkA08G069510 | RubberDandelionOmics

Gene overview

TkA08G069510

Reference: TK1151 Chr: Chr08 Coordinates: 17900882-17906349 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2945 bp · TkA08G069510|TK1151|cDNA

ATGAAAGAGGGTAGCCCACGAAAAAGTTCAAACACTTTTCCCTGTGAAGGGGGTGTCGGAAAACCCTTTGTTAAACCCTCGCCGGCACAACACACAAGTGAAAACGTCCTCCGTGATGGCCAACGCCGGAACTATTCGAACGTTTGAAGATTTTCTGAAGGTTCATGGTATACTACTTGCAGCTGCCGGTATTCCTCAGTCACTTTACCGGAAGCTCTTTGAAAAGCTGTCGACCGAAACTTTCGACGGAGGCAACTACT...

CDS

Download CDS FASTA

2595 bp · TkA08G069510|TK1151|CDS

ATGGCCAACGCCGGAACTATTCGAACGTTTGAAGATTTTCTGAAGGTTCATGGTATACTACTTGCAGCTGCCGGTATTCCTCAGTCACTTTACCGGAAGCTCTTTGAAAAGCTGTCGACCGAAACTTTCGACGGAGGCAACTACTTCCAGGTGGAGCCGGTGGAGGATGGCCGTCAAAGGCGTCTTGTACTCACCACCTCGGATTCCATGCGGAAGGAATCAAACATTTTTCTCGTTGATCATGCCTTATCCTTTCGCCT...

Protein

Download Protein FASTA

864 aa · TkA08G069510|TK1151|PROTEIN

MANAGTIRTFEDFLKVHGILLAAAGIPQSLYRKLFEKLSTETFDGGNYFQVEPVEDGRQRRLVLTTSDSMRKESNIFLVDHALSFRLSDAPKQLQEVPGLVERMASLMCVDIDLKSDDEDADNVDDNKLTVVEIVEREFEKVKKEGYDAVTWLELEDLNIDDDIFVSLDLPTKFPDLIALSLCNNKLKLTETITNEIVKFKHLRALWLNNNPIIQNLDDDVTDDIIHKFPKLEILNSSFTRNYTGWALGFCGGIYNNDNP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G069510`
TK1151 ID	TkA08G069510
OH-1004 ID	LXL04_035820
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	96.300
Protein coverage (%)	TK1151 9.491 / OH-1004 22.043 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G069510`
Location	Chr08:17900882-17906349 (-)
Description	Similar to CYP80B1: (S)-N-methylcoclaurine 3'-hydroxylase isozyme 1 (Fragment)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_035820` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0033075 isoquinoline alkaloid biosynthetic process Biological Process GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0016020 membrane Cellular Component GO:0004497 monooxygenase activity Molecular Function GO:0005506 iron ion binding Molecular Function GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen Molecular Function GO:0020037 heme binding Molecular Function GO:0050593 N-methylcoclaurine 3'-monooxygenase activity Molecular Function
KEGG gene cross-reference	ag:AAC39452 ag:AAC39453 ag:ABD39696 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.700

Rank 1 · TkA08G069510 · TK1151

Nucleus0.338

Rank 2 · TkA08G069510 · TK1151

Cell membrane0.071

Rank 3 · TkA08G069510 · TK1151

Mitochondrion0.067

Rank 4 · TkA08G069510 · TK1151

Endoplasmic reticulum0.056

Rank 5 · TkA08G069510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25556SET_TTL61-120 aa

PF24048LRR_NXF1-5158-235 aa

PF12799LRR_4167-189 aa

PF13855LRR_8172-213 aa

PF12799LRR_4177-218 aa

PF00560LRR_1177-193 aa

PF12799LRR_4202-236 aa

PF00560LRR_1202-217 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G069510	`PF25556`	SET_TTL	61	120	2.1e-38	132.5
TkA08G069510	`PF24048`	LRR_NXF1-5	158	235	0.00016	22.0
TkA08G069510	`PF12799`	LRR_4	167	189	4.1e-05	24.4
TkA08G069510	`PF13855`	LRR_8	172	213	1.5e-05	25.4
TkA08G069510	`PF12799`	LRR_4	177	218	4.1e-05	24.4
TkA08G069510	`PF00560`	LRR_1	177	193	0.14	13.0
TkA08G069510	`PF12799`	LRR_4	202	236	4.1e-05	24.4
TkA08G069510	`PF00560`	LRR_1	202	217	0.14	13.0
TkA08G069510	`PF24048`	LRR_NXF1-5	270	309	0.00016	22.0
TkA08G069510	`PF13855`	LRR_8	272	310	1.5e-05	25.4
TkA08G069510	`PF12799`	LRR_4	272	310	4.1e-05	24.4
TkA08G069510	`PF00560`	LRR_1	273	287	0.14	13.0
TkA08G069510	`PF00560`	LRR_1	297	312	0.14	13.0
TkA08G069510	`PF12799`	LRR_4	346	355	4.1e-05	24.4
TkA08G069510	`PF25556`	SET_TTL	387	491	2.1e-38	132.5
TkA08G069510	`PF03133`	TTL	582	831	6.4e-51	174.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card