TkA08G068510 | RubberDandelionOmics

Gene overview

TkA08G068510

Reference: TK1151 Chr: Chr08 Coordinates: 17631533-17632099 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

567 bp · TkA08G068510|TK1151|cDNA

ATGGCCACCGTCACCGGCGCCGCCGTCATCCTCCTCATCCTCACCATTCTCTCCGTCGCCACAACCGTCGTCCCCTCATCCCCCTCCCCACCCTCAGATCTAATCCGTTCCTCCTGCCTCCACGCCACCTTCCCGAAAGTCTGCGTCAACACCCTCACCGTCTACAAAGGCCGCGCCACCACTCCCCGGGAGCTAGCACAGGCGGCGATAAAAATCAGCATCTCTCGCGCCTCAAAGGCATCGGAATTTCTCTCCGGGTT...

CDS

Download CDS FASTA

567 bp · TkA08G068510|TK1151|CDS

ATGGCCACCGTCACCGGCGCCGCCGTCATCCTCCTCATCCTCACCATTCTCTCCGTCGCCACAACCGTCGTCCCCTCATCCCCCTCCCCACCCTCAGATCTAATCCGTTCCTCCTGCCTCCACGCCACCTTCCCGAAAGTCTGCGTCAACACCCTCACCGTCTACAAAGGCCGCGCCACCACTCCCCGGGAGCTAGCACAGGCGGCGATAAAAATCAGCATCTCTCGCGCCTCAAAGGCATCGGAATTTCTCTCCGGGTT...

Protein

Download Protein FASTA

188 aa · TkA08G068510|TK1151|PROTEIN

MATVTGAAVILLILTILSVATTVVPSSPSPPSDLIRSSCLHATFPKVCVNTLTVYKGRATTPRELAQAAIKISISRASKASEFLSGLQKEANKREMGAVKDCASQISDSVDDLRKTLGELKQLRRGTFRWQMSNAETWVSAALTNEDTCIDGFKEIEGTVRSDVKKKVTNVAKVTSNALYLINRLDHP

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G068510`
TK1151 ID	TkA08G068510
OH-1004 ID	LXL04_018567
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G068510

Location Chr08:17631533-17632099 (+)

Description Similar to PMEI3: Pectinesterase inhibitor 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20740`	Pectin methylesterase (PME) inhibitor that can target PMEs (e.g. PME2 and PME3) in a pH-dependent manner, mainly in slightly acidic conditions (pH 6.3 and 5.0) but not at pH 7.5.	Biochemical characterization of Pectin Methylesterase Inhibitor 3 from Arabidopsis thaliana .2022 · DOI: 10.1016/j.tcsw.2022.100080
`At1g62770`	Pectin methylesterase (PME) inhibitor that probably targets root-expressed PME and PME3 in a moderate pH-dependent manner, mainly in slightly acidic conditions (pH 6.3 and 5.0) and to some extent at pH 7.5.	Combined Experimental and Computational Approaches Reveal Distinct pH Dependence of Pectin Methylesterase Inhibitors.2017 · DOI: 10.1104/pp.16.01790
`At3g47380`	Pectin methylesterase (PME) inhibitor involved in the maintenance of cell wall integrity in response to necrotrophic pathogens.	No verified direct reference in this release
`At1g62760`	Pectin methylesterase (PME) inhibitor involved in the maintenance of cell wall integrity in response to necrotrophic pathogens.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018567 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009641 shade avoidance Biological Process

GO:0009827 plant-type cell wall modification Biological Process

GO:0071669 plant-type cell wall organization or biogenesis Biological Process

GO:1902183 regulation of shoot apical meristem development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048046 apoplast Cellular Component

GO:0004857 enzyme inhibitor activity Molecular Function

GO:0046910 pectinesterase inhibitor activity Molecular Function

KEGG gene cross-reference

ath:AT1G62770

ath:AT3G47380

ath:AT4G25260

ath:AT5G20740

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.638

Rank 1 · TkA08G068510 · TK1151

Endoplasmic reticulum0.136

Rank 2 · TkA08G068510 · TK1151

Cytoplasm0.085

Rank 3 · TkA08G068510 · TK1151

Cell membrane0.084

Rank 4 · TkA08G068510 · TK1151

Lysosome / Vacuole0.052

Rank 5 · TkA08G068510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04043PMEI33-181 aa

PF29599Rv0250c48-75 aa

PF06141Phage_tail_U49-144 aa

PF29653YqxI65-115 aa

PF29670TP_0584_N81-133 aa

PF29599Rv0250c94-125 aa

PF06518DUF1104101-171 aa

PF29653YqxI125-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G068510	`PF04043`	PMEI	33	181	5.1e-41	141.1
TkA08G068510	`PF29599`	Rv0250c	48	75	0.22	12.3
TkA08G068510	`PF06141`	Phage_tail_U	49	144	0.23	12.3
TkA08G068510	`PF29653`	YqxI	65	115	0.16	13.4
TkA08G068510	`PF29670`	TP_0584_N	81	133	0.26	11.3
TkA08G068510	`PF29599`	Rv0250c	94	125	0.22	12.3
TkA08G068510	`PF06518`	DUF1104	101	171	0.17	13.0
TkA08G068510	`PF29653`	YqxI	125	175	0.16	13.4
TkA08G068510	`PF29599`	Rv0250c	161	161	0.22	12.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84WE4`	Arabidopsis thaliana	sp\|Q84WE4\|PMEI3_ARATH Pectinesterase inhibitor 3	50.900%	Swiss-Prot	High
`Q9SI72`	Arabidopsis thaliana	sp\|Q9SI72\|PMEI9_ARATH Pectinesterase inhibitor 9	42.800%	Swiss-Prot	Medium
`Q9STY5`	Arabidopsis thaliana	sp\|Q9STY5\|PMI11_ARATH Pectinesterase inhibitor 11	41.900%	Swiss-Prot	Medium
`Q9SI74`	Arabidopsis thaliana	sp\|Q9SI74\|PMI10_ARATH Pectinesterase inhibitor 10	38.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card