TkA08G066610 | RubberDandelionOmics

Gene overview

TkA08G066610

Reference: TK1151 Chr: Chr08 Coordinates: 17142318-17146885 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2834 bp · TkA08G066610|TK1151|cDNA

CATTTTCGGACATTGCTAAAAGATCCGATTCACACTTTCGGTTCTACCCGGTTTGCCCCATCAAAGCTTTATCATCAACAAGACGAAAAACCGGAGCCAACACTCCAGGCTCTGATGCTCGTTGTCACCCTTCCATGCTCAACCATGGTGGTTCGAACGGTAAATTCAATATCACTCCTCAGGTCCTCTTCTCCGCCACATCCCCTGCCATTTCCAGCGTTCCGGTACCACCAAATTCGAGCTTATCAGTATTTGCAGCT...

CDS

Download CDS FASTA

2532 bp · TkA08G066610|TK1151|CDS

CATTTTCGGACATTGCTAAAAGATCCGATTCACACTTTCGGTTCTACCCGGTTTGCCCCATCAAAGCTTTATCATCAACAAGACGAAAAACCGGAGCCAACACTCCAGGCTCTGATGCTCGTTGTCACCCTTCCATGCTCAACCATGGTGGTTCGAACGGTAAATTCAATATCACTCCTCAGGTCCTCTTCTCCGCCACATCCCCTGCCATTTCCAGCGTTCCGGTACCACCAAATTCGAGCTTATCAGTATTTGCAGCT...

Protein

Download Protein FASTA

843 aa · TkA08G066610|TK1151|PROTEIN

HFRTLLKDPIHTFGSTRFAPSKLYHQQDEKPEPTLQALMLVVTLPCSTMVVRTVNSISLLRSSSPPHPLPFPAFRYHQIRAYQYLQLSRVSIRNPMVFGYHNIKSGRSRSYSIQSFVDTVLEEFEALRRRRTVRASNKSVLTSSKELVEDKLRKQVLQKGLLLEFKKDTDRILLAVVQKPDGRKNWIVSDQNGVSTSIKPQQITYIVPGVDNFNTTEISDFNQRAQNNLDPALLEFAWMELLETNKSVTVEELAEMIFGS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G066610`
TK1151 ID	TkA08G066610
OH-1004 ID	LXL04_018531
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 99.526 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G066610

Location Chr08:17142318-17146885 (+)

Description Similar to RNR1: Ribonuclease II, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g02250`	3'-5' exoribonuclease that catalyzes 3' maturation of chloroplast and mitochondrion ribosomal RNAs; degrades short nucleotidic extensions to generate the mature 3'-ends.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018531 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006364 rRNA processing Biological Process

GO:0006402 mRNA catabolic process Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0000932 P-body Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000175 3'-5'-RNA exonuclease activity Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0004540 RNA nuclease activity Molecular Function

GO:0008859 exoribonuclease II activity Molecular Function

KEGG gene cross-reference

ath:AT5G02250

bsu:BSU33610

cmu:TC_0676

ctr:CT_397

syn:sll1290

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.658

Rank 1 · TkA08G066610 · TK1151

Mitochondrion0.411

Rank 2 · TkA08G066610 · TK1151

Cytoplasm0.032

Rank 3 · TkA08G066610 · TK1151

Nucleus0.029

Rank 4 · TkA08G066610 · TK1151

Cell membrane0.010

Rank 5 · TkA08G066610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23163CSD_RNase_II157-218 aa

PF00773RNB195-267 aa

PF25255WHD_RNase_II221-299 aa

PF23161HTH_RNase_II300-403 aa

PF23161HTH_RNase_II429-458 aa

PF00773RNB437-732 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G066610	`PF23163`	CSD_RNase_II	157	218	3.6e-27	94.7
TkA08G066610	`PF00773`	RNB	195	267	2.8e-76	257.6
TkA08G066610	`PF25255`	WHD_RNase_II	221	299	5.1e-30	104.1
TkA08G066610	`PF23161`	HTH_RNase_II	300	403	4.4e-28	98.7
TkA08G066610	`PF23161`	HTH_RNase_II	429	458	4.4e-28	98.7
TkA08G066610	`PF00773`	RNB	437	732	2.8e-76	257.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6NQJ6`	Arabidopsis thaliana	sp\|Q6NQJ6\|RNR1_ARATH Ribonuclease II, chloroplastic/mitochondrial	64.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card