TkA08G062930 | RubberDandelionOmics

Gene overview

TkA08G062930

Reference: TK1151 Chr: Chr08 Coordinates: 16074668-16077531 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1403 bp · TkA08G062930|TK1151|cDNA

TCTTTGTTTGCAGAAAAAGGCGAAATTGGGGGCAAAGAAAGCGAGAAATGGCATTCTTATCCATCTGTGGAACGAACAGGGTCGACGATTCCGACTGCTTCTGAAGTTAGCGTTGACGAAATTCGATCGGCCGCCACCGGCTCGGATCGTTACCCTGCTTCTCTACATGCCCCGTTGATGAGTTCTCCGGAGCCTCCTCCCTATATTCCTGAGCAACCTTTTCCATACCAGTCCGGCTATGGCGGACAATACGGTCAAAC...

CDS

Download CDS FASTA

1278 bp · TkA08G062930|TK1151|CDS

ATGGAGCAACCCCTGCTTAGTGAAAAAGGCGAAATTGGGGGCAAAGAAAGCGAGAAATGGCATTCTTATCCATCTGTGGAACGAACAGGGTCGACGATTCCGACTGCTTCTGAAGTTAGCGTTGACGAAATTCGATCGGCCGCCACCGGCTCGGATCGTTACCCTGCTTCTCTACATGCCCCGTTGATGAGTTCTCCGGAGCCTCCTCCCTATATTCCTGAGCAACCTTTTCCATACCAGTCCGGCTATGGCGGACAATA...

Protein

Download Protein FASTA

425 aa · TkA08G062930|TK1151|PROTEIN

MEQPLLSEKGEIGGKESEKWHSYPSVERTGSTIPTASEVSVDEIRSAATGSDRYPASLHAPLMSSPEPPPYIPEQPFPYQSGYGGQYGQTEHQAHRQILDEVEIRELLLDHVGHRCCWGSRPARNWKIHSVEDCNVYVGTLETFVEQREVVTETEPYRGGKSIDGKDKKAPEPGVWELDLRSEFPVLFTHHKECRAPIPNSESINKCQDCEGRGDIVCGKCNANQEPGVYKENQMSQCGACYGRGLIAHRDGSDTLCVKC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G062930`
TK1151 ID	TkA08G062930
OH-1004 ID	LXL04_018469
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	74.600
Protein coverage (%)	TK1151 99.059 / OH-1004 93.950 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G062930`
Location	Chr08:16074668-16077531 (-)
Description	Similar to ssuh2: Protein SSUH2 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_018469` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0031072 heat shock protein binding Molecular Function GO:0051082 unfolded protein binding Molecular Function
KEGG gene cross-reference	dre:767720 hsa:51066 mmu:243612 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.611

Rank 1 · TkA08G062930 · TK1151

Nucleus0.282

Rank 2 · TkA08G062930 · TK1151

Cell membrane0.224

Rank 3 · TkA08G062930 · TK1151

Golgi apparatus0.098

Rank 4 · TkA08G062930 · TK1151

Mitochondrion0.088

Rank 5 · TkA08G062930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00684DnaJ_CXXCXGXG204-223 aa

PF15777Anti-TRAP206-253 aa

PF30758Orange_C207-275 aa

PF25436BSD2_CRD207-264 aa

PF00684DnaJ_CXXCXGXG218-273 aa

PF15777Anti-TRAP255-291 aa

PF25436BSD2_CRD256-276 aa

PF00684DnaJ_CXXCXGXG257-290 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G062930	`PF00684`	DnaJ_CXXCXGXG	204	223	0.048	14.7
TkA08G062930	`PF15777`	Anti-TRAP	206	253	0.059	14.1
TkA08G062930	`PF30758`	Orange_C	207	275	0.14	13.2
TkA08G062930	`PF25436`	BSD2_CRD	207	264	6.8	7.7
TkA08G062930	`PF00684`	DnaJ_CXXCXGXG	218	273	0.048	14.7
TkA08G062930	`PF15777`	Anti-TRAP	255	291	0.059	14.1
TkA08G062930	`PF25436`	BSD2_CRD	256	276	6.8	7.7
TkA08G062930	`PF00684`	DnaJ_CXXCXGXG	257	290	0.048	14.7
TkA08G062930	`PF30758`	Orange_C	257	279	0.14	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card