TkA08G062910 | RubberDandelionOmics

Gene overview

TkA08G062910

Reference: TK1151 Chr: Chr08 Coordinates: 16064082-16068001 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2524 bp · TkA08G062910|TK1151|cDNA

GAAAACATTCTTAAAATTCAACGATCTGTGTTAACGTTTACGCGTAGGAAGAGGGGTGACTATAAATATACCCACCACCACCATGAACACCCTTGTGGCCGCCTTTTATTACGCCTTTTCCACTCTCCGCTTTCCACCATCTTTTAATTCAAAATTCTTTCTAATCCCTTCATTCCAACGCCCAAATCCACTCCTCCTATCCATTTCGATCCTTAATTTCACTTTTCTTTTGTTTCGATTTCGAGATTCCCCGTCTTTTG...

CDS

Download CDS FASTA

1353 bp · TkA08G062910|TK1151|CDS

ATGCCCAAAAGGGTGTATGAGAAATCCCATTACAATCCTGTCCCTGAAATTTGGATGAAATCAAACAGCAGTCGCTATCATCAATGCATTGCTAGACCTCGGAATCAAAGCAAAAGCAGCTCCATAACAAACGGATATCTTCTCGTTCATGCCAACGGCGGATTGAACCAAATGAGAACAGGGATATGTGACATGGTGGCGATCGCCAAAATGATGAACGCCACTCTAGTTCTCCCATCTCTCGATCATCAATCTTTTTG...

Protein

Download Protein FASTA

450 aa · TkA08G062910|TK1151|PROTEIN

MPKRVYEKSHYNPVPEIWMKSNSSRYHQCIARPRNQSKSSSITNGYLLVHANGGLNQMRTGICDMVAIAKMMNATLVLPSLDHQSFWTDPSDFKDIFDWRHFINDLKDDVHIVESLPPEYENHKPFDKAPVSWSKASYYRGEMRQLLRKQKVVKFTHSDSRLVNNGLPSSYQKLRCRANYEALRYSDEIETLGKKLVARLRSDDEPYIALHLRYEKDMLAFTGCSHNLTTEEHQELETMRYDVKHWKEKDINGTERRQQG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G062910`
TK1151 ID	TkA08G062910
OH-1004 ID	LXL04_018467
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 97.333 / OH-1004 67.281 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G062910

Location Chr08:16064082-16068001 (-)

Description Similar to OFUT28: O-fucosyltransferase 28

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g37980`	O-fucosyltransferase 19.	No verified direct reference in this release
`At3g54100`	O-fucosyltransferase 28.	No verified direct reference in this release
`At5g01100`	Glycosyltransferase required for normal cell adhesion and cell wall integrity.	The FRIABLE1 gene product affects cell adhesion in Arabidopsis.2012 · DOI: 10.1371/journal.pone.0042914
`At5g35570`	O-fucosyltransferase 35.	No verified direct reference in this release
`At5g64600`	O-fucosyltransferase 38.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018467 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006004 fucose metabolic process Biological Process

GO:0007155 cell adhesion Biological Process

GO:0010214 seed coat development Biological Process

GO:0010395 rhamnogalacturonan I metabolic process Biological Process

GO:0045489 pectin biosynthetic process Biological Process

GO:0071555 cell wall organization Biological Process

GO:0080157 regulation of plant-type cell wall organization or biogenesis Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT2G37980

ath:AT3G54100

ath:AT5G01100

ath:AT5G15740

ath:AT5G35570

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.773

Rank 1 · TkA08G062910 · TK1151

Endoplasmic reticulum0.097

Rank 2 · TkA08G062910 · TK1151

Cell membrane0.067

Rank 3 · TkA08G062910 · TK1151

Cytoplasm0.063

Rank 4 · TkA08G062910 · TK1151

Extracellular0.050

Rank 5 · TkA08G062910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10250O-FucT46-361 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G062910	`PF10250`	O-FucT	46	361	4.5e-108	362.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SH89`	Arabidopsis thaliana	sp\|Q9SH89\|OFT19_ARATH O-fucosyltransferase 19	73.100%	Swiss-Prot	High
`Q9M393`	Arabidopsis thaliana	sp\|Q9M393\|OFT28_ARATH O-fucosyltransferase 28	72.100%	Swiss-Prot	High
`Q9LFC6`	Arabidopsis thaliana	sp\|Q9LFC6\|FRB1_ARATH Protein FRIABLE 1	67.800%	Swiss-Prot	High
`Q94BY4`	Arabidopsis thaliana	sp\|Q94BY4\|OFT35_ARATH O-fucosyltransferase 35	63.900%	Swiss-Prot	High
`F4KF16`	Arabidopsis thaliana	sp\|F4KF16\|OFT38_ARATH O-fucosyltransferase 38	47.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card