TkA08G054240 | RubberDandelionOmics

Gene overview

TkA08G054240

Reference: TK1151 Chr: Chr08 Coordinates: 13890596-13891307 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

450 bp · TkA08G054240|TK1151|cDNA

CTGTTCAACTGCTTACATTCTTGTCTCCAACCCATCGATGTCATCAAGACCCGTTTACAACTTGACCGCCGCGCCGGTCACTACAAGGGCATTCTCCATTGCGGCAACACCACCGTCACAAACGAAGGCGTCCGTGCTCTTTGGAAAGGGTTTGACGCCCTTCGCCACTCACTGACATTGAAATATGCCCTCCGGATGGGCTCCAATGCCGTGATTCAATCGGCGTTTAAAGATGCCAACACCGGTAGTGAAAATACGAC...

CDS

Download CDS FASTA

450 bp · TkA08G054240|TK1151|CDS

CTGTTCAACTGCTTACATTCTTGTCTCCAACCCATCGATGTCATCAAGACCCGTTTACAACTTGACCGCCGCGCCGGTCACTACAAGGGCATTCTCCATTGCGGCAACACCACCGTCACAAACGAAGGCGTCCGTGCTCTTTGGAAAGGGTTTGACGCCCTTCGCCACTCACTGACATTGAAATATGCCCTCCGGATGGGCTCCAATGCCGTGATTCAATCGGCGTTTAAAGATGCCAACACCGGTAGTGAAAATACGAC...

Protein

Download Protein FASTA

149 aa · TkA08G054240|TK1151|PROTEIN

LFNCLHSCLQPIDVIKTRLQLDRRAGHYKGILHCGNTTVTNEGVRALWKGFDALRHSLTLKYALRMGSNAVIQSAFKDANTGSENTTTTTKGLAQDLLNLPPLDFEAHNTSLVSGAGTSGVQEAISMEEKSRAQAWFSNMRSSAETAEN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G054240`
TK1151 ID	TkA08G054240
OH-1004 ID	LXL04_017716
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	72.800
Protein coverage (%)	TK1151 87.248 / OH-1004 90.230 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G054240

Location Chr08:13890596-13891307 (-)

Description Similar to SFC1: Mitochondrial succinate-fumarate transporter 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g01340`	May transport cytoplasmic succinate, derived from fatty acid oxidation, into the mitochondrial matrix in exchange of fumarate during lipid mobilization in seed germination.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017716 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006843 mitochondrial citrate transmembrane transport Biological Process

GO:0007528 neuromuscular junction development Biological Process

GO:0010821 regulation of mitochondrion organization Biological Process

GO:0015741 fumarate transport Biological Process

GO:0015742 alpha-ketoglutarate transport Biological Process

GO:0015743 malate transport Biological Process

GO:0015744 succinate transport Biological Process

GO:0015746 citrate transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0031966 mitochondrial membrane Cellular Component

GO:0005469 succinate:fumarate antiporter activity Molecular Function

KEGG gene cross-reference

ath:AT5G01340

dre:393579

sce:YJR095W

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.854

Rank 1 · TkA08G054240 · TK1151

Cytoplasm0.056

Rank 2 · TkA08G054240 · TK1151

Plastid0.049

Rank 3 · TkA08G054240 · TK1151

Nucleus0.032

Rank 4 · TkA08G054240 · TK1151

Cell membrane0.019

Rank 5 · TkA08G054240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00153Mito_carr6-72 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G054240	`PF00153`	Mito_carr	6	72	1.5e-12	47.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M038`	Arabidopsis thaliana	sp\|Q9M038\|SFC1_ARATH Mitochondrial succinate-fumarate transporter 1	70.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card