Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1278 bp · TkA08G040190|TK1151|cDNA
ATGGTCAAACCAGCTGACCCAACATGGTCCGGTAAGCTATCCTTATCAGAACTTGACCAAACTGGTGTCACCACTCATGTCCCGACCATTTACTTCTACTCAAACTCCCCTCAAGATTGGGCCACTGTCCTACAAACCCTAAAAACATCACTAAGTTCTACCCTAGTTCACTTCTACCCAATGGCCGGCCGGCTATCTTCCATTGCCGGAGGCCGTGATAGTCTTTTACCATCTCCGATATACCACCAACTTATCCCTTC...
1278 bp · TkA08G040190|TK1151|CDS
ATGGTCAAACCAGCTGACCCAACATGGTCCGGTAAGCTATCCTTATCAGAACTTGACCAAACTGGTGTCACCACTCATGTCCCGACCATTTACTTCTACTCAAACTCCCCTCAAGATTGGGCCACTGTCCTACAAACCCTAAAAACATCACTAAGTTCTACCCTAGTTCACTTCTACCCAATGGCCGGCCGGCTATCTTCCATTGCCGGAGGCCGTGATAGTCTTTTACCATCTCCGATATACCACCAACTTATCCCTTC...
Protein
Download Protein FASTA425 aa · TkA08G040190|TK1151|PROTEIN
MVKPADPTWSGKLSLSELDQTGVTTHVPTIYFYSNSPQDWATVLQTLKTSLSSTLVHFYPMAGRLSSIAGGRDSLLPSPIYHQLIPSIDYQNTPFEEIPLLVLQVTRFACGGFSLGVNISHVVADGQSALHFVSEWARISRGEVLDSPPYLDRKLLRAGEPPRSTATSRFEHSEFDPPPVLLDQSGNERESEKPTAVTMLKLTATQVEKLRNKANRSQTSDITRGFTRYETVTAHIWRTACKARNHKPEQPTALAICVDI...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G040190 |
|---|---|
| TK1151 ID | TkA08G040190 |
| OH-1004 ID | LXL04_003071 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 62.000 |
| Protein coverage (%) | TK1151 98.118 / OH-1004 97.788Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G040190 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:10211071-10212420 (+) | |||||||||
| Description | Similar to SHT: Spermidine hydroxycinnamoyl transferase | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006952 defense response Biological Process GO:0009411 response to UV Biological Process GO:0009555 pollen development Biological Process GO:0009698 phenylpropanoid metabolic process Biological Process GO:0009751 response to salicylic acid Biological Process GO:0009753 response to jasmonic acid Biological Process GO:0009820 alkaloid metabolic process Biological Process GO:0010584 pollen exine formation Biological Process GO:0080088 spermidine hydroxycinnamate conjugate biosynthetic process Biological Process GO:0005737 cytoplasm Cellular Component GO:0016410 N-acyltransferase activity Molecular Function GO:0016747 acyltransferase activity, transferring groups other than amino-acyl groups Molecular Function | |||||||||
| KEGG gene cross-reference | ag:BAC78633 ath:AT2G19070 nta:107796658 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02458Transferase1-67 aaPF02458Transferase76-413 aaPF16911PapA_C196-272 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G040190 | PF02458 | Transferase | 1 | 67 | 4.5e-100 | 336.0 |
| TkA08G040190 | PF02458 | Transferase | 76 | 413 | 4.5e-100 | 336.0 |
| TkA08G040190 | PF16911 | PapA_C | 196 | 272 | 0.12 | 12.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.