TkA08G021660 | RubberDandelionOmics

Gene overview

TkA08G021660

Reference: TK1151 Chr: Chr08 Coordinates: 5442890-5444672 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1379 bp · TkA08G021660|TK1151|cDNA

CTCAAAATGATTAATAAGTTGTTTTTATAAGCACAAAGACAAAGGTAAATGCGACATGACTCATGATTTTAGTGCGACCCCAAGTTTGGTACCTTTTTATCGGAAAGCCATTGGTTAATCACGCTGCCCACGTCCTCCTTCGTTGGCGTATGCTCTTCCTCGTGCAATCACTACTCACTACCCATGAAGCTTCGTACCTCTTTCCTCCTTCCATTATTTTTCACGAAACTTCCATCAACATTAAATCAATCAATTACAAT...

CDS

Download CDS FASTA

417 bp · TkA08G021660|TK1151|CDS

ATGGTGAATCAAACTGAAGAAGATGAGAAGTTAGGAGGGGTCGCTAGAGAAGCCAAAGAAAGGTTGGATGGGAGGCTAAGAGGCCATCTAAAAAAAGATATTACAAGGAAGAAGAGTCAAGAAAGATCGGGTAGTGTTGGGAGGACAACTACTCCAATGGTGGTAGAAAATTTGCAAGTTGAGGTTTTTGGATTAAAAAAGAGTGGATTAAGGAGGCTTAGTTGGGGAAGAACAGGGTTGAGTTGGAAGTCAATGAATCA...

Protein

Download Protein FASTA

138 aa · TkA08G021660|TK1151|PROTEIN

MVNQTEEDEKLGGVAREAKERLDGRLRGHLKKDITRKKSQERSGSVGRTTTPMVVENLQVEVFGLKKSGLRRLSWGRTGLSWKSMNQEECAICLDHLKANEKVIHLPCTHRFHSDCLVPWLERNSHCPCCRTIVIGSN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G021660`
TK1151 ID	TkA08G021660
OH-1004 ID	LXL04_018187
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 71.503 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G021660

Location Chr08:5442890-5444672 (+)

Description Similar to rnf126-b: E3 ubiquitin-protein ligase RNF126-B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0488800`	Possesses E3 ubiqutin-protein ligase activity in vitro.	Molecular dissection of Oryza sativa salt-induced RING Finger Protein 1 (OsSIRP1): possible involvement in the sensitivity response to salinity stress.2016 · DOI: 10.1111/ppl.12459

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018187 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006513 protein monoubiquitination Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0035519 protein K29-linked ubiquitination Biological Process

GO:0042059 negative regulation of epidermal growth factor receptor signaling pathway Biological Process

GO:0042127 regulation of cell population proliferation Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0043162 ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway Biological Process

GO:0044314 protein K27-linked ubiquitination Biological Process

GO:0070534 protein K63-linked ubiquitination Biological Process

GO:0070936 protein K48-linked ubiquitination Biological Process

KEGG gene cross-reference

ath:AT3G19950

bta:507447

hsa:55658

xla:432033

xtr:448402

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.601

Rank 1 · TkA08G021660 · TK1151

Cytoplasm0.344

Rank 2 · TkA08G021660 · TK1151

Cell membrane0.098

Rank 3 · TkA08G021660 · TK1151

Mitochondrion0.044

Rank 4 · TkA08G021660 · TK1151

Endoplasmic reticulum0.042

Rank 5 · TkA08G021660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19147DUF582960-122 aa

PF27618Zn_ribbon_GTF2H282-93 aa

PF29452FAR1_N84-131 aa

PF17120zf-RING_1685-129 aa

PF12678zf-rbx187-131 aa

PF13920zf-C3HC4_387-134 aa

PF05883Baculo_RING87-115 aa

PF26148VPS18_RING_C88-117 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G021660	`PF19147`	DUF5829	60	122	0.024	15.0
TkA08G021660	`PF27618`	Zn_ribbon_GTF2H2	82	93	3.4	8.1
TkA08G021660	`PF29452`	FAR1_N	84	131	0.00058	20.5
TkA08G021660	`PF17120`	zf-RING_16	85	129	0.09	13.1
TkA08G021660	`PF12678`	zf-rbx1	87	131	4.6e-06	27.5
TkA08G021660	`PF13920`	zf-C3HC4_3	87	134	1.7e-05	25.3
TkA08G021660	`PF05883`	Baculo_RING	87	115	0.14	12.8
TkA08G021660	`PF26148`	VPS18_RING_C	88	117	0.0035	18.1
TkA08G021660	`PF13639`	zf-RING_2	89	131	2.2e-13	50.9
TkA08G021660	`PF17123`	zf-RING_11	89	117	1.7e-10	41.1
TkA08G021660	`PF13923`	zf-C3HC4_2	89	130	1.6e-09	38.1
TkA08G021660	`PF14634`	zf-RING_5	89	132	0.00081	20.0
TkA08G021660	`PF25998`	U-box_ZFPL1	89	123	0.12	13.4
TkA08G021660	`PF11793`	FANCL_C	89	126	2.6	9.1
TkA08G021660	`PF00097`	zf-C3HC4	90	130	5.3e-07	30.1
TkA08G021660	`PF13445`	zf-RING_UBOX	90	128	4.9e-05	24.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6AVN2`	Oryza sativa subsp. japonica	sp\|Q6AVN2\|SIRP1_ORYSJ E3 ubiquitin-protein ligase SIRP1	50.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card