TkA08G018670 | RubberDandelionOmics

Gene overview

TkA08G018670

Reference: TK1151 Chr: Chr08 Coordinates: 4632458-4635924 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2281 bp · TkA08G018670|TK1151|cDNA

TATACCCAAAAATTTGTAAACCAATGTACGGGGTACGTGAGGGTGAACTTAAAGTCTTCCGAAACCCATTAAAATCTTTTTGGTTTAAAAATTAGGGGAAAAAGAACACGTAGGTAGAGAGATGGAGAGCGCTAAGCCGTCGTCTTCGGCGCCGCCGTACCCAGGAGGAGGTGCCGGTGCCGGCGGGAAATTCAGGAAGCCTCCTATTTCAAGGAAACGGCCGTCTACTCCTTACGATCGTCCATCACTCACTACTGGTA...

CDS

Download CDS FASTA

1998 bp · TkA08G018670|TK1151|CDS

ATGGAGAGCGCTAAGCCGTCGTCTTCGGCGCCGCCGTACCCAGGAGGAGGTGCCGGTGCCGGCGGGAAATTCAGGAAGCCTCCTATTTCAAGGAAACGGCCGTCTACTCCTTACGATCGTCCATCACTCACTACTGGTAATAATAAACCGGGCGATTCTCAAGACAATGGCGGTGGCTGGTTGTCGAAGCTTGTTGTCAATCCTGCTCGCCGTCTCATCGTCGGTGGTGCCACCAGAATACTGCCATCGTTTTTCTCCAA...

Protein

Download Protein FASTA

665 aa · TkA08G018670|TK1151|PROTEIN

MESAKPSSSAPPYPGGGAGAGGKFRKPPISRKRPSTPYDRPSLTTGNNKPGDSQDNGGGWLSKLVVNPARRLIVGGATRILPSFFSKSDSSSADEYEDDPSSDDDDQEVGATEIPRTDANHTMELGVSRWSGAAGPSNETDKLKCSLVKSLQQDEPKNSPGDHGLTEIENMLKGKQFSRDERNRLMEILNSRMIDVSNTEDPKKSPPVISHGKAKEVHTIGKQYNTESTVLETPMPNSQSNMQDEVTASPIDIARAYMGN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G018670`
TK1151 ID	TkA08G018670
OH-1004 ID	LXL04_018243
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G018670

Location Chr08:4632458-4635924 (+)

Description Similar to NUP1: Nuclear pore complex protein NUP1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10650`	Nucleoporin required for nuclear mRNA export.	Arabidopsis homolog of the yeast TREX-2 mRNA export complex: components and anchoring nucleoporin.2010 · DOI: 10.1111/j.1365-313x.2009.04048.x Identification and characterization of nuclear pore complex components in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.079947 Involvement of the nuclear pore complex in morphology of the plant nucleus.2011 · DOI: 10.4161/nucl.2.3.16175

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018243 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006997 nucleus organization Biological Process

GO:0015031 protein transport Biological Process

GO:0016973 poly(A)+ mRNA export from nucleus Biological Process

GO:0071763 nuclear membrane organization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005643 nuclear pore Cellular Component

GO:0005829 cytosol Cellular Component

GO:0034399 nuclear periphery Cellular Component

KEGG gene cross-reference

ath:AT3G10650

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.888

Rank 1 · TkA08G018670 · TK1151

Cytoplasm0.176

Rank 2 · TkA08G018670 · TK1151

Cell membrane0.053

Rank 3 · TkA08G018670 · TK1151

Endoplasmic reticulum0.040

Rank 4 · TkA08G018670 · TK1151

Plastid0.024

Rank 5 · TkA08G018670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30350COG1_C134-173 aa

PF30350COG1_C454-475 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G018670	`PF30350`	COG1_C	134	173	0.086	13.7
TkA08G018670	`PF30350`	COG1_C	454	475	0.086	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAF4`	Arabidopsis thaliana	sp\|Q9CAF4\|NUP1_ARATH Nuclear pore complex protein NUP1	31.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card