TkA08G010150 | RubberDandelionOmics

Gene overview

TkA08G010150

Reference: TK1151 Chr: Chr08 Coordinates: 2530843-2537979 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

883 bp · TkA08G010150|TK1151|cDNA

ATATTCTATACTACCAATGATATATTTAACGTACAAATTTAACTTTTTTTTTTTTCTTTCAGGAAGGAGTTGACACTGATCTTGCACTCTGCCTTTCAAGCCTTTATCAATGAAGGTTTTGGAATGCTCCTTTACTTCAGGCATAAAGTTGGAGAAGGTTCCACAATTGCTTAAAATGCTACAACCAAAACAAATCTTGGTTCCAGATTACGCAAAACCATTCTTGGAACCTTTGAGCAACTCATTGCCATGTCTATTTT...

CDS

Download CDS FASTA

1365 bp · TkA08G010150|TK1151|CDS

ATGAAATTTACAAGTTTAGGGAAAGGTGGAGGTTACAATCTGCCAGCATGTCACATGATGAAGTTATCTGGTTTCCATATCTTATTAGATTGCCCTCTTGACCTCTCTGCTCTTACAATCTTTTCACCGATTTCTTGTACAAGTTTATATGATGATGAAGAAGAAGAGATGGTTGATTTAATATCTTTAGAACCTTTTTATAAAACTATTGAAGGAGTGCAGCTATGGAATGTCTCTCTGATTGATGTTGTTTTGATTTC...

Protein

Download Protein FASTA

454 aa · TkA08G010150|TK1151|PROTEIN

MKFTSLGKGGGYNLPACHMMKLSGFHILLDCPLDLSALTIFSPISCTSLYDDEEEEMVDLISLEPFYKTIEGVQLWNVSLIDVVLISSPMGMLGLPFLTRTKGFSAKIYATEATTRLSEFMMKDLVSMHMEFKQRYGPHKNSFFEFFNWEKLESLPPSLKDILLGKDGTQLGSWMPLYSAGDVKECLQKVESVVYAQETCYNGSLIIKAFSSGLEIGACNWSLKSPKRNISYISRSIFTSGVAMDFDLHALIGTDVLIYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G010150`
TK1151 ID	TkA08G010150
OH-1004 ID	LXL04_034336
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	96.900
Protein coverage (%)	TK1151 98.458 / OH-1004 69.876 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G010150`
Location	Chr08:2530843-2537979 (-)
Description	Similar to ints9: Integrator complex subunit 9 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_034336` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016180 snRNA processing Biological Process GO:0034243 regulation of transcription elongation by RNA polymerase II Biological Process GO:0034472 snRNA 3'-end processing Biological Process GO:0090101 negative regulation of transmembrane receptor protein serine/threonine kinase signaling pathway Biological Process GO:0090287 regulation of cellular response to growth factor stimulus Biological Process GO:0160240 RNA polymerase II transcription initiation surveillance Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0032039 integrator complex Cellular Component GO:0160232 INTAC complex Cellular Component
KEGG gene cross-reference	bta:533964 hsa:55756 nve:5510608 xla:446380 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.674

Rank 1 · TkA08G010150 · TK1151

Cytoplasm0.305

Rank 2 · TkA08G010150 · TK1151

Cell membrane0.040

Rank 3 · TkA08G010150 · TK1151

Mitochondrion0.032

Rank 4 · TkA08G010150 · TK1151

Endoplasmic reticulum0.026

Rank 5 · TkA08G010150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16661Lactamase_B_620-34 aa

PF10996Beta-Casp25-44 aa

PF16661Lactamase_B_678-233 aa

PF17030Beta_lactamase3181-259 aa

PF10996Beta-Casp321-437 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G010150	`PF16661`	Lactamase_B_6	20	34	1.6e-08	34.9
TkA08G010150	`PF10996`	Beta-Casp	25	44	6.2e-09	37.2
TkA08G010150	`PF16661`	Lactamase_B_6	78	233	1.6e-08	34.9
TkA08G010150	`PF17030`	Beta_lactamase3	181	259	0.014	15.4
TkA08G010150	`PF10996`	Beta-Casp	321	437	6.2e-09	37.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card